Incidental Mutation 'R1921:Wnt2'
ID213047
Institutional Source Beutler Lab
Gene Symbol Wnt2
Ensembl Gene ENSMUSG00000010797
Gene Namewingless-type MMTV integration site family, member 2
Synonymsm-irp, Irp, 2610510E18Rik, Int1l1, Mirp, Wnt2a, Wnt-2
MMRRC Submission 039939-MU
Accession Numbers

Genbank: NM_023653.5; Ensembl: ENSMUST00000010941

Is this an essential gene? Possibly non essential (E-score: 0.456) question?
Stock #R1921 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location17988940-18030585 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 18030253 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 12 (L12P)
Ref Sequence ENSEMBL: ENSMUSP00000010941 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010941]
Predicted Effect unknown
Transcript: ENSMUST00000010941
AA Change: L12P
SMART Domains Protein: ENSMUSP00000010941
Gene: ENSMUSG00000010797
AA Change: L12P

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
WNT1 43 349 5.1e-213 SMART
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 94.9%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the WNT gene family. The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. Alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants exhibit impaired placental vascularization, runting and 50% perinatal mortality resulting from difficulties in breathing and nursing. Survivors of the perinatal period tend to recover, and adults are healthy and fertile. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(1) Targeted, other(3)

Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik A G 7: 118,833,748 N568S probably damaging Het
A2m C A 6: 121,654,612 L623M probably benign Het
Abhd2 T C 7: 79,348,356 I212T possibly damaging Het
Adam7 A C 14: 68,512,625 S449A possibly damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Aox3 T C 1: 58,180,651 Y1137H probably damaging Het
Atp11b T C 3: 35,834,325 Y715H probably damaging Het
Atrn A G 2: 130,995,051 Y1145C probably damaging Het
Btbd7 A G 12: 102,793,796 I631T probably benign Het
Cadps T C 14: 12,465,859 K1017R possibly damaging Het
Cfap45 A G 1: 172,545,112 E458G probably damaging Het
Cptp C T 4: 155,866,538 R157H probably damaging Het
Dcbld1 A C 10: 52,319,651 E318D possibly damaging Het
Ddr2 G T 1: 170,004,245 P197Q probably damaging Het
Dlg5 T C 14: 24,176,571 Y421C probably damaging Het
Dlgap2 A G 8: 14,843,624 K980E probably benign Het
Drc7 T C 8: 95,056,016 V3A unknown Het
Dst T C 1: 34,161,029 V96A probably damaging Het
Ect2l T C 10: 18,143,004 D548G possibly damaging Het
Efcab10 A T 12: 33,398,435 Y89F probably benign Het
Eif1ad CGAGGAGGAGGAGGAGGAGG CGAGGAGGAGGAGGAGG 19: 5,370,058 probably benign Het
Entpd6 A G 2: 150,758,812 T147A probably damaging Het
Fbxl5 T A 5: 43,765,490 E189D probably benign Het
Fer1l6 T A 15: 58,625,231 S1217T probably damaging Het
Frem2 A T 3: 53,653,495 V1197D possibly damaging Het
Fsip2 T A 2: 82,980,783 L2482* probably null Het
Fsip2 A T 2: 82,986,820 D4299V probably benign Het
Gipc3 T A 10: 81,338,215 I242F probably damaging Het
Hoxb1 T A 11: 96,366,112 Y96N probably damaging Het
Ibsp A G 5: 104,310,212 E205G probably damaging Het
Ibtk A G 9: 85,703,082 S1170P probably benign Het
Igfn1 A G 1: 135,966,063 probably null Het
Iqsec1 A G 6: 90,662,895 S954P probably benign Het
Kalrn A T 16: 34,392,093 D28E probably benign Het
Lrmda T C 14: 22,577,870 F52L probably damaging Het
Lrp2 T C 2: 69,523,287 D543G probably damaging Het
Lrrtm3 T C 10: 64,088,378 T337A probably benign Het
Marf1 C T 16: 14,128,601 D1219N possibly damaging Het
Mkln1 A G 6: 31,428,178 K118R probably benign Het
Nedd4l T C 18: 65,167,575 probably null Het
Neu2 A G 1: 87,597,301 E336G probably benign Het
Nfasc A G 1: 132,610,805 F448S probably damaging Het
Nlrx1 C A 9: 44,254,134 E822* probably null Het
Nr5a1 T C 2: 38,694,096 Y437C probably damaging Het
Olfr1224-ps1 A G 2: 89,156,581 V198A probably benign Het
Olfr1353 T A 10: 78,970,141 L164* probably null Het
Olfr885 T C 9: 38,061,685 Y122H probably damaging Het
Phtf1 C T 3: 103,969,122 Q13* probably null Het
Pnldc1 A G 17: 12,888,928 L525P possibly damaging Het
Ppl T A 16: 5,106,124 D162V possibly damaging Het
Prkdc T A 16: 15,714,215 S1448T possibly damaging Het
Ptgdr A G 14: 44,853,281 I340T probably benign Het
Recql T C 6: 142,365,589 I458M probably benign Het
Rrbp1 A T 2: 143,988,291 V652E probably benign Het
Rtp1 T A 16: 23,431,410 I175N probably damaging Het
Ryr1 A G 7: 29,054,944 M3523T probably damaging Het
S100a16 T C 3: 90,542,396 L62P probably damaging Het
Samd11 T C 4: 156,248,709 E364G probably damaging Het
Satb1 C A 17: 51,742,115 G603* probably null Het
Shroom3 T A 5: 92,962,365 probably null Het
Slc25a15 A G 8: 22,395,761 S3P probably benign Het
Socs2 A T 10: 95,413,038 L71* probably null Het
Sptbn1 T C 11: 30,104,469 E2208G probably damaging Het
St14 A G 9: 31,089,870 V855A possibly damaging Het
Susd1 T A 4: 59,412,191 T121S probably benign Het
Svs3b A T 2: 164,255,928 S158T probably benign Het
Synpo C T 18: 60,603,589 M428I probably benign Het
Syt10 C T 15: 89,790,776 D456N probably damaging Het
Taar4 A G 10: 23,961,341 D283G probably damaging Het
Tango6 T A 8: 106,688,794 D82E probably benign Het
Tcof1 T C 18: 60,838,855 T127A possibly damaging Het
Tle3 G A 9: 61,411,340 probably null Het
Tmem45a A G 16: 56,822,302 F169L probably benign Het
Trp53rkb T A 2: 166,795,823 V233E probably damaging Het
Ttc7b C T 12: 100,415,130 probably null Het
Tubgcp3 A T 8: 12,621,932 L770* probably null Het
Tut1 G A 19: 8,966,102 G851D probably benign Het
Ubr1 G A 2: 120,930,968 T576I probably benign Het
Vmn1r125 T A 7: 21,272,605 Y143N probably damaging Het
Vmn2r120 T A 17: 57,524,839 I317F probably benign Het
Vmn2r95 T A 17: 18,424,313 N70K probably benign Het
Wdr59 A T 8: 111,486,950 L311* probably null Het
Xrn1 T C 9: 95,999,497 I700T probably benign Het
Ypel1 A G 16: 17,082,579 H98R probably benign Het
Zfp219 T C 14: 52,008,234 T434A probably benign Het
Zik1 A C 7: 10,490,016 C385G probably damaging Het
Other mutations in Wnt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03264:Wnt2 APN 6 17989960 missense probably benign 0.22
1mM(1):Wnt2 UTSW 6 18008623 missense probably damaging 1.00
R1165:Wnt2 UTSW 6 17989947 missense probably benign
R1771:Wnt2 UTSW 6 18008697 missense probably damaging 0.97
R1782:Wnt2 UTSW 6 18008640 missense possibly damaging 0.65
R1836:Wnt2 UTSW 6 18023235 missense probably damaging 1.00
R2009:Wnt2 UTSW 6 18030209 missense probably damaging 0.98
R3749:Wnt2 UTSW 6 18023168 missense probably benign 0.00
R4831:Wnt2 UTSW 6 18023286 missense probably benign 0.19
R4888:Wnt2 UTSW 6 18023126 missense possibly damaging 0.89
R4924:Wnt2 UTSW 6 18023240 missense probably damaging 1.00
R5121:Wnt2 UTSW 6 18023126 missense possibly damaging 0.89
R5660:Wnt2 UTSW 6 18028146 missense probably benign 0.09
R5767:Wnt2 UTSW 6 17990028 missense probably damaging 0.97
R6005:Wnt2 UTSW 6 18030323 start gained probably benign
R6670:Wnt2 UTSW 6 18028092 missense possibly damaging 0.90
R7205:Wnt2 UTSW 6 18028047 missense probably benign 0.11
R7711:Wnt2 UTSW 6 17990037 missense probably benign 0.44
R7732:Wnt2 UTSW 6 18023336 missense probably damaging 1.00
R8249:Wnt2 UTSW 6 18030285 start codon destroyed probably null
Predicted Primers PCR Primer
(F):5'- AGACATGGTTGTTTCAGAATCCAC -3'
(R):5'- GCTGGGCTCGTCTTTTGAAAC -3'

Sequencing Primer
(F):5'- GGTTGTTTCAGAATCCACAACTGC -3'
(R):5'- TGAGTCTCACCACTAGCCG -3'
Posted On2014-07-14