Incidental Mutation 'R1921:Recql'
ID213051
Institutional Source Beutler Lab
Gene Symbol Recql
Ensembl Gene ENSMUSG00000030243
Gene NameRecQ protein-like
SynonymsRecQ1
MMRRC Submission 039939-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.292) question?
Stock #R1921 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location142350342-142387087 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 142365589 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 458 (I458M)
Ref Sequence ENSEMBL: ENSMUSP00000107434 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032370] [ENSMUST00000041852] [ENSMUST00000100832] [ENSMUST00000111803]
Predicted Effect probably benign
Transcript: ENSMUST00000032370
AA Change: I458M

PolyPhen 2 Score 0.411 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000032370
Gene: ENSMUSG00000030243
AA Change: I458M

DomainStartEndE-ValueType
coiled coil region 6 51 N/A INTRINSIC
DEXDc 88 291 2.5e-27 SMART
HELICc 328 409 2.2e-26 SMART
Pfam:RQC 488 592 5.5e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000041852
SMART Domains Protein: ENSMUSP00000036394
Gene: ENSMUSG00000041671

DomainStartEndE-ValueType
Pfam:Pyr_redox_2 8 234 2.2e-18 PFAM
Pfam:Pyr_redox_2 266 381 4e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100832
AA Change: I458M

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000098394
Gene: ENSMUSG00000030243
AA Change: I458M

DomainStartEndE-ValueType
coiled coil region 6 51 N/A INTRINSIC
DEXDc 88 291 6e-25 SMART
HELICc 328 409 5.51e-24 SMART
Pfam:RQC 488 592 1.1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111803
AA Change: I458M

PolyPhen 2 Score 0.411 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000107434
Gene: ENSMUSG00000030243
AA Change: I458M

DomainStartEndE-ValueType
coiled coil region 6 51 N/A INTRINSIC
DEXDc 88 291 6e-25 SMART
HELICc 328 409 5.51e-24 SMART
Pfam:RecQ_Zn_bind 420 479 2.5e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123912
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137098
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138578
Predicted Effect unknown
Transcript: ENSMUST00000141504
AA Change: I47M
SMART Domains Protein: ENSMUSP00000119452
Gene: ENSMUSG00000030243
AA Change: I47M

DomainStartEndE-ValueType
Pfam:RecQ_Zn_bind 10 69 7.1e-16 PFAM
Pfam:RQC 73 187 2.5e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143102
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154870
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155149
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 94.9%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the RecQ DNA helicase family. DNA helicases are enzymes involved in various types of DNA repair, including mismatch repair, nucleotide excision repair and direct repair. The encoded protein is involved in the processing of Holliday junctions, the suppression of sister chromatid exchanges, telomere maintenance, and is required for genotoxic stress resistance. Defects in this gene have been associated with several types of cancer. [provided by RefSeq, Jan 2017]
PHENOTYPE: Homozygous mutation of this gene results in chromosomal instability, with embryonic fibroblasts exhibiting aneuploidy, spontaneous chromosomal breakage, frequent translocation events, increased sensitivity to ionizing radiation, and increased frequency of sister chromatid exchange. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik A G 7: 118,833,748 N568S probably damaging Het
A2m C A 6: 121,654,612 L623M probably benign Het
Abhd2 T C 7: 79,348,356 I212T possibly damaging Het
Adam7 A C 14: 68,512,625 S449A possibly damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Aox3 T C 1: 58,180,651 Y1137H probably damaging Het
Atp11b T C 3: 35,834,325 Y715H probably damaging Het
Atrn A G 2: 130,995,051 Y1145C probably damaging Het
Btbd7 A G 12: 102,793,796 I631T probably benign Het
Cadps T C 14: 12,465,859 K1017R possibly damaging Het
Cfap45 A G 1: 172,545,112 E458G probably damaging Het
Cptp C T 4: 155,866,538 R157H probably damaging Het
Dcbld1 A C 10: 52,319,651 E318D possibly damaging Het
Ddr2 G T 1: 170,004,245 P197Q probably damaging Het
Dlg5 T C 14: 24,176,571 Y421C probably damaging Het
Dlgap2 A G 8: 14,843,624 K980E probably benign Het
Drc7 T C 8: 95,056,016 V3A unknown Het
Dst T C 1: 34,161,029 V96A probably damaging Het
Ect2l T C 10: 18,143,004 D548G possibly damaging Het
Efcab10 A T 12: 33,398,435 Y89F probably benign Het
Eif1ad CGAGGAGGAGGAGGAGGAGG CGAGGAGGAGGAGGAGG 19: 5,370,058 probably benign Het
Entpd6 A G 2: 150,758,812 T147A probably damaging Het
Fbxl5 T A 5: 43,765,490 E189D probably benign Het
Fer1l6 T A 15: 58,625,231 S1217T probably damaging Het
Frem2 A T 3: 53,653,495 V1197D possibly damaging Het
Fsip2 T A 2: 82,980,783 L2482* probably null Het
Fsip2 A T 2: 82,986,820 D4299V probably benign Het
Gipc3 T A 10: 81,338,215 I242F probably damaging Het
Hoxb1 T A 11: 96,366,112 Y96N probably damaging Het
Ibsp A G 5: 104,310,212 E205G probably damaging Het
Ibtk A G 9: 85,703,082 S1170P probably benign Het
Igfn1 A G 1: 135,966,063 probably null Het
Iqsec1 A G 6: 90,662,895 S954P probably benign Het
Kalrn A T 16: 34,392,093 D28E probably benign Het
Lrmda T C 14: 22,577,870 F52L probably damaging Het
Lrp2 T C 2: 69,523,287 D543G probably damaging Het
Lrrtm3 T C 10: 64,088,378 T337A probably benign Het
Marf1 C T 16: 14,128,601 D1219N possibly damaging Het
Mkln1 A G 6: 31,428,178 K118R probably benign Het
Nedd4l T C 18: 65,167,575 probably null Het
Neu2 A G 1: 87,597,301 E336G probably benign Het
Nfasc A G 1: 132,610,805 F448S probably damaging Het
Nlrx1 C A 9: 44,254,134 E822* probably null Het
Nr5a1 T C 2: 38,694,096 Y437C probably damaging Het
Olfr1224-ps1 A G 2: 89,156,581 V198A probably benign Het
Olfr1353 T A 10: 78,970,141 L164* probably null Het
Olfr885 T C 9: 38,061,685 Y122H probably damaging Het
Phtf1 C T 3: 103,969,122 Q13* probably null Het
Pnldc1 A G 17: 12,888,928 L525P possibly damaging Het
Ppl T A 16: 5,106,124 D162V possibly damaging Het
Prkdc T A 16: 15,714,215 S1448T possibly damaging Het
Ptgdr A G 14: 44,853,281 I340T probably benign Het
Rrbp1 A T 2: 143,988,291 V652E probably benign Het
Rtp1 T A 16: 23,431,410 I175N probably damaging Het
Ryr1 A G 7: 29,054,944 M3523T probably damaging Het
S100a16 T C 3: 90,542,396 L62P probably damaging Het
Samd11 T C 4: 156,248,709 E364G probably damaging Het
Satb1 C A 17: 51,742,115 G603* probably null Het
Shroom3 T A 5: 92,962,365 probably null Het
Slc25a15 A G 8: 22,395,761 S3P probably benign Het
Socs2 A T 10: 95,413,038 L71* probably null Het
Sptbn1 T C 11: 30,104,469 E2208G probably damaging Het
St14 A G 9: 31,089,870 V855A possibly damaging Het
Susd1 T A 4: 59,412,191 T121S probably benign Het
Svs3b A T 2: 164,255,928 S158T probably benign Het
Synpo C T 18: 60,603,589 M428I probably benign Het
Syt10 C T 15: 89,790,776 D456N probably damaging Het
Taar4 A G 10: 23,961,341 D283G probably damaging Het
Tango6 T A 8: 106,688,794 D82E probably benign Het
Tcof1 T C 18: 60,838,855 T127A possibly damaging Het
Tle3 G A 9: 61,411,340 probably null Het
Tmem45a A G 16: 56,822,302 F169L probably benign Het
Trp53rkb T A 2: 166,795,823 V233E probably damaging Het
Ttc7b C T 12: 100,415,130 probably null Het
Tubgcp3 A T 8: 12,621,932 L770* probably null Het
Tut1 G A 19: 8,966,102 G851D probably benign Het
Ubr1 G A 2: 120,930,968 T576I probably benign Het
Vmn1r125 T A 7: 21,272,605 Y143N probably damaging Het
Vmn2r120 T A 17: 57,524,839 I317F probably benign Het
Vmn2r95 T A 17: 18,424,313 N70K probably benign Het
Wdr59 A T 8: 111,486,950 L311* probably null Het
Wnt2 A G 6: 18,030,253 L12P unknown Het
Xrn1 T C 9: 95,999,497 I700T probably benign Het
Ypel1 A G 16: 17,082,579 H98R probably benign Het
Zfp219 T C 14: 52,008,234 T434A probably benign Het
Zik1 A C 7: 10,490,016 C385G probably damaging Het
Other mutations in Recql
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00673:Recql APN 6 142376921 missense probably null 0.34
IGL01933:Recql APN 6 142364638 missense probably benign 0.33
IGL02026:Recql APN 6 142366668 nonsense probably null
IGL03181:Recql APN 6 142378192 missense probably benign 0.00
K3955:Recql UTSW 6 142378206 nonsense probably null
R0380:Recql UTSW 6 142369430 missense probably damaging 1.00
R1371:Recql UTSW 6 142372875 missense probably damaging 0.99
R1742:Recql UTSW 6 142364572 missense probably damaging 1.00
R1780:Recql UTSW 6 142364598 missense probably benign 0.00
R2032:Recql UTSW 6 142367283 missense probably damaging 1.00
R2966:Recql UTSW 6 142363587 missense probably benign 0.10
R4666:Recql UTSW 6 142376841 missense probably damaging 1.00
R4779:Recql UTSW 6 142363700 intron probably benign
R4863:Recql UTSW 6 142359006 utr 3 prime probably benign
R5115:Recql UTSW 6 142358559 utr 3 prime probably benign
R5400:Recql UTSW 6 142362347 intron probably benign
R5781:Recql UTSW 6 142365618 splice site probably null
R5981:Recql UTSW 6 142372878 missense probably damaging 1.00
R6372:Recql UTSW 6 142376840 missense probably damaging 1.00
R6651:Recql UTSW 6 142364434 critical splice donor site probably null
R6786:Recql UTSW 6 142364552 missense probably benign 0.43
R7399:Recql UTSW 6 142374884 missense probably damaging 1.00
R7515:Recql UTSW 6 142374885 missense probably damaging 1.00
R8097:Recql UTSW 6 142374911 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGCTGCCCCTAGTTTAGC -3'
(R):5'- GTTGAGAGATGACTGAGCTCAC -3'

Sequencing Primer
(F):5'- GACATACACATTTGACCTACTTTGG -3'
(R):5'- TCACAGTTGACAGCTCTGAG -3'
Posted On2014-07-14