Incidental Mutation 'R1921:Ryr1'
ID213054
Institutional Source Beutler Lab
Gene Symbol Ryr1
Ensembl Gene ENSMUSG00000030592
Gene Nameryanodine receptor 1, skeletal muscle
Synonymsskrr, calcium release channel isoform 1, Ryr
MMRRC Submission 039939-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1921 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location29003344-29125179 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 29054944 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 3523 (M3523T)
Ref Sequence ENSEMBL: ENSMUSP00000032813 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032813] [ENSMUST00000179893] [ENSMUST00000214374]
Predicted Effect probably damaging
Transcript: ENSMUST00000032813
AA Change: M3523T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000032813
Gene: ENSMUSG00000030592
AA Change: M3523T

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
MIR 99 154 7.52e-4 SMART
MIR 161 206 1.11e-6 SMART
MIR 212 266 1.23e-8 SMART
MIR 272 362 1.05e-25 SMART
Pfam:RYDR_ITPR 441 645 1.2e-73 PFAM
SPRY 660 798 2.79e-27 SMART
Pfam:RyR 851 945 6.5e-33 PFAM
Pfam:RyR 965 1059 1.5e-30 PFAM
SPRY 1086 1209 8.62e-42 SMART
low complexity region 1318 1332 N/A INTRINSIC
low complexity region 1340 1349 N/A INTRINSIC
SPRY 1431 1571 3.05e-33 SMART
low complexity region 1787 1798 N/A INTRINSIC
coiled coil region 1871 1932 N/A INTRINSIC
low complexity region 1989 1998 N/A INTRINSIC
low complexity region 2048 2057 N/A INTRINSIC
low complexity region 2069 2092 N/A INTRINSIC
Pfam:RYDR_ITPR 2158 2366 7e-66 PFAM
low complexity region 2390 2404 N/A INTRINSIC
Pfam:RyR 2735 2829 9.7e-34 PFAM
Pfam:RyR 2855 2943 5.7e-32 PFAM
low complexity region 3130 3144 N/A INTRINSIC
low complexity region 3290 3304 N/A INTRINSIC
low complexity region 3375 3394 N/A INTRINSIC
PDB:2BCX|B 3613 3642 2e-13 PDB
low complexity region 3681 3691 N/A INTRINSIC
low complexity region 3735 3760 N/A INTRINSIC
Pfam:RIH_assoc 3872 4004 1.9e-41 PFAM
low complexity region 4010 4023 N/A INTRINSIC
Pfam:EF-hand_8 4085 4136 9.8e-8 PFAM
transmembrane domain 4283 4305 N/A INTRINSIC
transmembrane domain 4318 4336 N/A INTRINSIC
transmembrane domain 4341 4363 N/A INTRINSIC
Pfam:RR_TM4-6 4377 4666 2e-86 PFAM
Pfam:Ion_trans 4761 4932 3.4e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179893
AA Change: M3525T

PolyPhen 2 Score 0.159 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000137123
Gene: ENSMUSG00000030592
AA Change: M3525T

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
MIR 99 154 7.52e-4 SMART
MIR 161 206 1.11e-6 SMART
MIR 212 266 1.23e-8 SMART
MIR 272 362 1.05e-25 SMART
Pfam:RYDR_ITPR 443 638 4.5e-63 PFAM
SPRY 660 798 2.79e-27 SMART
Pfam:RyR 852 942 1.3e-37 PFAM
Pfam:RyR 966 1056 1.6e-28 PFAM
SPRY 1086 1209 8.62e-42 SMART
low complexity region 1318 1332 N/A INTRINSIC
low complexity region 1340 1349 N/A INTRINSIC
SPRY 1431 1571 3.05e-33 SMART
low complexity region 1787 1798 N/A INTRINSIC
coiled coil region 1871 1932 N/A INTRINSIC
low complexity region 1989 1998 N/A INTRINSIC
low complexity region 2048 2057 N/A INTRINSIC
low complexity region 2069 2092 N/A INTRINSIC
Pfam:RYDR_ITPR 2160 2366 2.2e-68 PFAM
low complexity region 2390 2404 N/A INTRINSIC
Pfam:RyR 2736 2826 7.2e-31 PFAM
Pfam:RyR 2856 2940 5.6e-27 PFAM
low complexity region 3130 3144 N/A INTRINSIC
low complexity region 3290 3304 N/A INTRINSIC
low complexity region 3375 3394 N/A INTRINSIC
PDB:2BCX|B 3615 3644 2e-13 PDB
low complexity region 3683 3693 N/A INTRINSIC
low complexity region 3737 3762 N/A INTRINSIC
Pfam:RIH_assoc 3878 3996 6.2e-35 PFAM
low complexity region 4012 4025 N/A INTRINSIC
Pfam:EF-hand_8 4087 4137 1.8e-8 PFAM
transmembrane domain 4285 4307 N/A INTRINSIC
transmembrane domain 4320 4338 N/A INTRINSIC
transmembrane domain 4343 4365 N/A INTRINSIC
Pfam:RR_TM4-6 4379 4668 8.4e-76 PFAM
Pfam:Ion_trans 4763 4946 2.8e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214374
AA Change: M3532T

PolyPhen 2 Score 0.247 (Sensitivity: 0.91; Specificity: 0.88)
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 94.9%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ryanodine receptor found in skeletal muscle. The encoded protein functions as a calcium release channel in the sarcoplasmic reticulum but also serves to connect the sarcoplasmic reticulum and transverse tubule. Mutations in this gene are associated with malignant hyperthermia susceptibility, central core disease, and minicore myopathy with external ophthalmoplegia. Alternatively spliced transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation and a similar ENU-induced mutation are born with a rounded body shape, edema, thin and misshapened ribs, and abnormal muscle fibers. Mutants die perinatally. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik A G 7: 118,833,748 N568S probably damaging Het
A2m C A 6: 121,654,612 L623M probably benign Het
Abhd2 T C 7: 79,348,356 I212T possibly damaging Het
Adam7 A C 14: 68,512,625 S449A possibly damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Aox3 T C 1: 58,180,651 Y1137H probably damaging Het
Atp11b T C 3: 35,834,325 Y715H probably damaging Het
Atrn A G 2: 130,995,051 Y1145C probably damaging Het
Btbd7 A G 12: 102,793,796 I631T probably benign Het
Cadps T C 14: 12,465,859 K1017R possibly damaging Het
Cfap45 A G 1: 172,545,112 E458G probably damaging Het
Cptp C T 4: 155,866,538 R157H probably damaging Het
Dcbld1 A C 10: 52,319,651 E318D possibly damaging Het
Ddr2 G T 1: 170,004,245 P197Q probably damaging Het
Dlg5 T C 14: 24,176,571 Y421C probably damaging Het
Dlgap2 A G 8: 14,843,624 K980E probably benign Het
Drc7 T C 8: 95,056,016 V3A unknown Het
Dst T C 1: 34,161,029 V96A probably damaging Het
Ect2l T C 10: 18,143,004 D548G possibly damaging Het
Efcab10 A T 12: 33,398,435 Y89F probably benign Het
Eif1ad CGAGGAGGAGGAGGAGGAGG CGAGGAGGAGGAGGAGG 19: 5,370,058 probably benign Het
Entpd6 A G 2: 150,758,812 T147A probably damaging Het
Fbxl5 T A 5: 43,765,490 E189D probably benign Het
Fer1l6 T A 15: 58,625,231 S1217T probably damaging Het
Frem2 A T 3: 53,653,495 V1197D possibly damaging Het
Fsip2 T A 2: 82,980,783 L2482* probably null Het
Fsip2 A T 2: 82,986,820 D4299V probably benign Het
Gipc3 T A 10: 81,338,215 I242F probably damaging Het
Hoxb1 T A 11: 96,366,112 Y96N probably damaging Het
Ibsp A G 5: 104,310,212 E205G probably damaging Het
Ibtk A G 9: 85,703,082 S1170P probably benign Het
Igfn1 A G 1: 135,966,063 probably null Het
Iqsec1 A G 6: 90,662,895 S954P probably benign Het
Kalrn A T 16: 34,392,093 D28E probably benign Het
Lrmda T C 14: 22,577,870 F52L probably damaging Het
Lrp2 T C 2: 69,523,287 D543G probably damaging Het
Lrrtm3 T C 10: 64,088,378 T337A probably benign Het
Marf1 C T 16: 14,128,601 D1219N possibly damaging Het
Mkln1 A G 6: 31,428,178 K118R probably benign Het
Nedd4l T C 18: 65,167,575 probably null Het
Neu2 A G 1: 87,597,301 E336G probably benign Het
Nfasc A G 1: 132,610,805 F448S probably damaging Het
Nlrx1 C A 9: 44,254,134 E822* probably null Het
Nr5a1 T C 2: 38,694,096 Y437C probably damaging Het
Olfr1224-ps1 A G 2: 89,156,581 V198A probably benign Het
Olfr1353 T A 10: 78,970,141 L164* probably null Het
Olfr885 T C 9: 38,061,685 Y122H probably damaging Het
Phtf1 C T 3: 103,969,122 Q13* probably null Het
Pnldc1 A G 17: 12,888,928 L525P possibly damaging Het
Ppl T A 16: 5,106,124 D162V possibly damaging Het
Prkdc T A 16: 15,714,215 S1448T possibly damaging Het
Ptgdr A G 14: 44,853,281 I340T probably benign Het
Recql T C 6: 142,365,589 I458M probably benign Het
Rrbp1 A T 2: 143,988,291 V652E probably benign Het
Rtp1 T A 16: 23,431,410 I175N probably damaging Het
S100a16 T C 3: 90,542,396 L62P probably damaging Het
Samd11 T C 4: 156,248,709 E364G probably damaging Het
Satb1 C A 17: 51,742,115 G603* probably null Het
Shroom3 T A 5: 92,962,365 probably null Het
Slc25a15 A G 8: 22,395,761 S3P probably benign Het
Socs2 A T 10: 95,413,038 L71* probably null Het
Sptbn1 T C 11: 30,104,469 E2208G probably damaging Het
St14 A G 9: 31,089,870 V855A possibly damaging Het
Susd1 T A 4: 59,412,191 T121S probably benign Het
Svs3b A T 2: 164,255,928 S158T probably benign Het
Synpo C T 18: 60,603,589 M428I probably benign Het
Syt10 C T 15: 89,790,776 D456N probably damaging Het
Taar4 A G 10: 23,961,341 D283G probably damaging Het
Tango6 T A 8: 106,688,794 D82E probably benign Het
Tcof1 T C 18: 60,838,855 T127A possibly damaging Het
Tle3 G A 9: 61,411,340 probably null Het
Tmem45a A G 16: 56,822,302 F169L probably benign Het
Trp53rkb T A 2: 166,795,823 V233E probably damaging Het
Ttc7b C T 12: 100,415,130 probably null Het
Tubgcp3 A T 8: 12,621,932 L770* probably null Het
Tut1 G A 19: 8,966,102 G851D probably benign Het
Ubr1 G A 2: 120,930,968 T576I probably benign Het
Vmn1r125 T A 7: 21,272,605 Y143N probably damaging Het
Vmn2r120 T A 17: 57,524,839 I317F probably benign Het
Vmn2r95 T A 17: 18,424,313 N70K probably benign Het
Wdr59 A T 8: 111,486,950 L311* probably null Het
Wnt2 A G 6: 18,030,253 L12P unknown Het
Xrn1 T C 9: 95,999,497 I700T probably benign Het
Ypel1 A G 16: 17,082,579 H98R probably benign Het
Zfp219 T C 14: 52,008,234 T434A probably benign Het
Zik1 A C 7: 10,490,016 C385G probably damaging Het
Other mutations in Ryr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Ryr1 APN 7 29102810 missense probably damaging 1.00
IGL00335:Ryr1 APN 7 29124960 splice site probably null
IGL00427:Ryr1 APN 7 29104737 splice site probably benign
IGL00559:Ryr1 APN 7 29012242 splice site probably benign
IGL00803:Ryr1 APN 7 29069645 missense possibly damaging 0.95
IGL00886:Ryr1 APN 7 29024229 missense probably damaging 1.00
IGL00948:Ryr1 APN 7 29020195 missense possibly damaging 0.78
IGL01017:Ryr1 APN 7 29082543 missense probably damaging 0.99
IGL01116:Ryr1 APN 7 29100202 splice site probably benign
IGL01385:Ryr1 APN 7 29056985 missense probably damaging 1.00
IGL01482:Ryr1 APN 7 29052337 missense probably damaging 1.00
IGL01529:Ryr1 APN 7 29075227 missense probably damaging 1.00
IGL01543:Ryr1 APN 7 29091076 missense probably damaging 1.00
IGL01653:Ryr1 APN 7 29078597 missense probably damaging 0.99
IGL01701:Ryr1 APN 7 29059810 missense probably damaging 0.98
IGL02051:Ryr1 APN 7 29071658 missense probably benign 0.16
IGL02152:Ryr1 APN 7 29052015 missense possibly damaging 0.95
IGL02271:Ryr1 APN 7 29094047 missense probably benign 0.07
IGL02321:Ryr1 APN 7 29078696 missense probably damaging 1.00
IGL02448:Ryr1 APN 7 29105066 splice site probably benign
IGL02472:Ryr1 APN 7 29040844 missense probably damaging 1.00
IGL02544:Ryr1 APN 7 29115599 missense probably benign 0.24
IGL02666:Ryr1 APN 7 29019763 missense unknown
IGL02672:Ryr1 APN 7 29004519 unclassified probably benign
IGL02677:Ryr1 APN 7 29110608 missense probably benign 0.18
IGL02686:Ryr1 APN 7 29069550 splice site probably benign
IGL02751:Ryr1 APN 7 29078774 missense probably damaging 1.00
IGL02899:Ryr1 APN 7 29048795 missense possibly damaging 0.53
IGL02926:Ryr1 APN 7 29061540 missense probably damaging 1.00
IGL02950:Ryr1 APN 7 29097459 missense probably damaging 1.00
IGL02960:Ryr1 APN 7 29060053 missense probably damaging 1.00
IGL02968:Ryr1 APN 7 29043893 missense probably damaging 1.00
IGL03070:Ryr1 APN 7 29070659 missense probably damaging 1.00
IGL03091:Ryr1 APN 7 29083486 missense possibly damaging 0.85
IGL03100:Ryr1 APN 7 29104593 missense probably damaging 1.00
IGL03107:Ryr1 APN 7 29075199 missense probably damaging 1.00
IGL03117:Ryr1 APN 7 29102964 missense probably damaging 1.00
IGL03118:Ryr1 APN 7 29015786 missense unknown
IGL03146:Ryr1 APN 7 29094032 missense probably benign 0.09
IGL03165:Ryr1 APN 7 29105040 missense probably benign 0.22
IGL03220:Ryr1 APN 7 29059855 missense probably damaging 1.00
R0017:Ryr1 UTSW 7 29047542 missense probably damaging 1.00
R0066:Ryr1 UTSW 7 29005567 unclassified probably benign
R0066:Ryr1 UTSW 7 29005567 unclassified probably benign
R0069:Ryr1 UTSW 7 29110505 splice site probably benign
R0148:Ryr1 UTSW 7 29052035 missense probably damaging 0.99
R0266:Ryr1 UTSW 7 29040679 missense probably damaging 1.00
R0346:Ryr1 UTSW 7 29067588 splice site probably benign
R0387:Ryr1 UTSW 7 29083367 splice site probably benign
R0454:Ryr1 UTSW 7 29036075 missense probably damaging 0.99
R0494:Ryr1 UTSW 7 29003793 splice site probably benign
R0533:Ryr1 UTSW 7 29078780 missense probably damaging 1.00
R0585:Ryr1 UTSW 7 29036076 missense probably damaging 1.00
R0591:Ryr1 UTSW 7 29104795 missense possibly damaging 0.68
R0624:Ryr1 UTSW 7 29074609 missense probably damaging 1.00
R0662:Ryr1 UTSW 7 29100189 missense probably damaging 1.00
R0849:Ryr1 UTSW 7 29040679 missense probably damaging 1.00
R0961:Ryr1 UTSW 7 29009697 missense unknown
R1052:Ryr1 UTSW 7 29096258 missense probably damaging 0.96
R1218:Ryr1 UTSW 7 29086109 missense possibly damaging 0.79
R1340:Ryr1 UTSW 7 29116012 missense probably damaging 0.99
R1513:Ryr1 UTSW 7 29070621 missense probably damaging 1.00
R1543:Ryr1 UTSW 7 29083537 missense possibly damaging 0.67
R1566:Ryr1 UTSW 7 29092175 missense possibly damaging 0.95
R1572:Ryr1 UTSW 7 29062191 missense probably damaging 1.00
R1623:Ryr1 UTSW 7 29095490 missense probably damaging 1.00
R1632:Ryr1 UTSW 7 29094261 missense probably benign 0.03
R1661:Ryr1 UTSW 7 29101738 missense probably damaging 0.98
R1665:Ryr1 UTSW 7 29036078 missense probably damaging 1.00
R1678:Ryr1 UTSW 7 29116154 missense probably damaging 0.99
R1705:Ryr1 UTSW 7 29078564 missense probably damaging 1.00
R1712:Ryr1 UTSW 7 29047503 missense probably benign 0.25
R1720:Ryr1 UTSW 7 29101870 missense probably damaging 0.99
R1799:Ryr1 UTSW 7 29067621 missense probably damaging 1.00
R1847:Ryr1 UTSW 7 29079811 missense probably benign 0.43
R1860:Ryr1 UTSW 7 29009552 missense unknown
R1861:Ryr1 UTSW 7 29009552 missense unknown
R1983:Ryr1 UTSW 7 29059472 missense possibly damaging 0.74
R2043:Ryr1 UTSW 7 29059631 missense probably damaging 0.99
R2089:Ryr1 UTSW 7 29086049 missense probably damaging 1.00
R2091:Ryr1 UTSW 7 29086049 missense probably damaging 1.00
R2091:Ryr1 UTSW 7 29086049 missense probably damaging 1.00
R2105:Ryr1 UTSW 7 29090150 missense probably damaging 0.99
R2175:Ryr1 UTSW 7 29068442 missense probably damaging 1.00
R2259:Ryr1 UTSW 7 29019741 missense unknown
R2291:Ryr1 UTSW 7 29098777 missense probably damaging 1.00
R2351:Ryr1 UTSW 7 29075293 missense probably benign 0.18
R2512:Ryr1 UTSW 7 29103542 missense possibly damaging 0.64
R2571:Ryr1 UTSW 7 29009562 missense unknown
R2571:Ryr1 UTSW 7 29036126 missense possibly damaging 0.94
R2885:Ryr1 UTSW 7 29074798 missense probably damaging 0.99
R2886:Ryr1 UTSW 7 29074798 missense probably damaging 0.99
R2889:Ryr1 UTSW 7 29078741 missense possibly damaging 0.76
R3051:Ryr1 UTSW 7 29053090 missense probably damaging 1.00
R3052:Ryr1 UTSW 7 29053090 missense probably damaging 1.00
R3053:Ryr1 UTSW 7 29053090 missense probably damaging 1.00
R3082:Ryr1 UTSW 7 29045646 missense probably damaging 1.00
R3103:Ryr1 UTSW 7 29074948 missense probably damaging 1.00
R3237:Ryr1 UTSW 7 29069650 critical splice acceptor site probably null
R3551:Ryr1 UTSW 7 29056997 missense probably damaging 1.00
R3552:Ryr1 UTSW 7 29056997 missense probably damaging 1.00
R3807:Ryr1 UTSW 7 29020152 missense probably damaging 1.00
R3815:Ryr1 UTSW 7 29072902 missense probably damaging 0.98
R4010:Ryr1 UTSW 7 29095124 missense probably benign 0.41
R4041:Ryr1 UTSW 7 29085931 missense possibly damaging 0.77
R4226:Ryr1 UTSW 7 29062151 nonsense probably null
R4257:Ryr1 UTSW 7 29082450 missense possibly damaging 0.93
R4328:Ryr1 UTSW 7 29083059 missense probably damaging 1.00
R4394:Ryr1 UTSW 7 29094242 missense possibly damaging 0.69
R4485:Ryr1 UTSW 7 29090156 missense probably damaging 0.97
R4550:Ryr1 UTSW 7 29098735 missense probably benign 0.05
R4554:Ryr1 UTSW 7 29105008 missense probably benign 0.03
R4562:Ryr1 UTSW 7 29074580 intron probably benign
R4642:Ryr1 UTSW 7 29086038 missense possibly damaging 0.91
R4669:Ryr1 UTSW 7 29059831 missense probably null 0.99
R4707:Ryr1 UTSW 7 29045662 missense probably damaging 1.00
R4766:Ryr1 UTSW 7 29085833 missense probably damaging 0.96
R4768:Ryr1 UTSW 7 29004821 unclassified probably benign
R4770:Ryr1 UTSW 7 29109282 missense probably damaging 0.99
R4780:Ryr1 UTSW 7 29095097 missense possibly damaging 0.85
R4927:Ryr1 UTSW 7 29019983 missense unknown
R4933:Ryr1 UTSW 7 29104298 missense probably damaging 1.00
R4934:Ryr1 UTSW 7 29068095 missense probably damaging 1.00
R4942:Ryr1 UTSW 7 29069573 missense probably damaging 0.98
R4960:Ryr1 UTSW 7 29078783 missense possibly damaging 0.82
R5007:Ryr1 UTSW 7 29069115 missense probably damaging 1.00
R5011:Ryr1 UTSW 7 29102809 splice site probably null
R5013:Ryr1 UTSW 7 29102809 splice site probably null
R5137:Ryr1 UTSW 7 29101858 missense possibly damaging 0.94
R5167:Ryr1 UTSW 7 29067693 missense probably damaging 1.00
R5239:Ryr1 UTSW 7 29036128 missense probably damaging 1.00
R5291:Ryr1 UTSW 7 29115598 missense probably benign 0.03
R5303:Ryr1 UTSW 7 29068482 missense probably damaging 1.00
R5386:Ryr1 UTSW 7 29117416 missense probably damaging 0.98
R5431:Ryr1 UTSW 7 29109812 missense probably benign 0.39
R5460:Ryr1 UTSW 7 29071961 missense probably damaging 1.00
R5463:Ryr1 UTSW 7 29024023 missense possibly damaging 0.79
R5503:Ryr1 UTSW 7 29069028 missense possibly damaging 0.87
R5541:Ryr1 UTSW 7 29086185 missense probably damaging 1.00
R5573:Ryr1 UTSW 7 29015723 missense unknown
R5575:Ryr1 UTSW 7 29078693 missense possibly damaging 0.77
R5610:Ryr1 UTSW 7 29111974 missense probably benign 0.05
R5658:Ryr1 UTSW 7 29091089 splice site probably null
R5918:Ryr1 UTSW 7 29009152 missense probably benign 0.39
R5926:Ryr1 UTSW 7 29104360 missense probably damaging 1.00
R5938:Ryr1 UTSW 7 29046865 missense probably damaging 1.00
R5939:Ryr1 UTSW 7 29116127 missense probably damaging 0.97
R5947:Ryr1 UTSW 7 29071924 missense probably null 0.98
R5991:Ryr1 UTSW 7 29104610 missense probably damaging 0.99
R5992:Ryr1 UTSW 7 29067637 missense probably damaging 1.00
R5996:Ryr1 UTSW 7 29024241 missense probably benign 0.38
R6075:Ryr1 UTSW 7 29087438 missense probably damaging 1.00
R6091:Ryr1 UTSW 7 29071973 missense probably benign 0.01
R6126:Ryr1 UTSW 7 29076239 missense probably null 1.00
R6147:Ryr1 UTSW 7 29085914 missense possibly damaging 0.88
R6235:Ryr1 UTSW 7 29116181 missense probably benign 0.07
R6279:Ryr1 UTSW 7 29087428 missense possibly damaging 0.93
R6381:Ryr1 UTSW 7 29075257 missense possibly damaging 0.87
R6441:Ryr1 UTSW 7 29059695 missense possibly damaging 0.95
R6443:Ryr1 UTSW 7 29077078 missense probably damaging 0.97
R6459:Ryr1 UTSW 7 29015654 missense probably benign 0.39
R6514:Ryr1 UTSW 7 29046841 missense probably damaging 1.00
R6563:Ryr1 UTSW 7 29095492 missense possibly damaging 0.92
R6660:Ryr1 UTSW 7 29038345 critical splice donor site probably null
R6746:Ryr1 UTSW 7 29117404 missense possibly damaging 0.56
R6785:Ryr1 UTSW 7 29064874 missense probably benign 0.12
R6800:Ryr1 UTSW 7 29024316 missense possibly damaging 0.95
R6939:Ryr1 UTSW 7 29052326 missense possibly damaging 0.91
R6980:Ryr1 UTSW 7 29109387 missense probably benign 0.03
R6995:Ryr1 UTSW 7 29094182 missense probably damaging 0.97
R7065:Ryr1 UTSW 7 29103643 missense probably damaging 1.00
R7123:Ryr1 UTSW 7 29046854 missense probably benign 0.37
R7238:Ryr1 UTSW 7 29095382 missense probably benign 0.24
R7240:Ryr1 UTSW 7 29052015 missense possibly damaging 0.95
R7300:Ryr1 UTSW 7 29059511 missense probably damaging 1.00
R7365:Ryr1 UTSW 7 29085755 missense probably benign 0.05
R7403:Ryr1 UTSW 7 29013867 missense probably benign 0.34
R7422:Ryr1 UTSW 7 29085870 missense probably benign 0.00
R7493:Ryr1 UTSW 7 29095205 missense probably benign 0.44
R7570:Ryr1 UTSW 7 29078585 missense probably damaging 0.98
R7593:Ryr1 UTSW 7 29036103 missense probably damaging 1.00
X0021:Ryr1 UTSW 7 29061531 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGTCTGACGTTCTGGAGAGC -3'
(R):5'- GGCAACCAGGTTAGATGCTG -3'

Sequencing Primer
(F):5'- AGAGCTTTGGGGAATGCTACATC -3'
(R):5'- CAACCAGGTTAGATGCTGGGTTG -3'
Posted On2014-07-14