Incidental Mutation 'R1921:Nlrx1'
ID213068
Institutional Source Beutler Lab
Gene Symbol Nlrx1
Ensembl Gene ENSMUSG00000032109
Gene NameNLR family member X1
Synonyms
MMRRC Submission 039939-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R1921 (G1)
Quality Score220
Status Not validated
Chromosome9
Chromosomal Location44252717-44268599 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 44254134 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 822 (E822*)
Ref Sequence ENSEMBL: ENSMUSP00000126555 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034618] [ENSMUST00000034621] [ENSMUST00000168499] [ENSMUST00000169651]
Predicted Effect probably benign
Transcript: ENSMUST00000034618
SMART Domains Protein: ENSMUSP00000034618
Gene: ENSMUSG00000032105

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
PDZ 58 130 2.04e-15 SMART
PDZ 165 235 2.93e-7 SMART
PDZ 271 346 2.47e-14 SMART
PDZ 403 475 1.4e-13 SMART
Predicted Effect probably null
Transcript: ENSMUST00000034621
AA Change: E822*
SMART Domains Protein: ENSMUSP00000034621
Gene: ENSMUSG00000032109
AA Change: E822*

DomainStartEndE-ValueType
Pfam:NACHT 160 325 1.1e-22 PFAM
low complexity region 543 556 N/A INTRINSIC
LRR 695 722 1.66e2 SMART
LRR 749 776 3.59e1 SMART
LRR 778 805 6.23e-2 SMART
LRR 806 833 1.13e0 SMART
LRR 834 861 1.99e1 SMART
LRR 862 885 8.11e1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000168499
AA Change: E822*
SMART Domains Protein: ENSMUSP00000127531
Gene: ENSMUSG00000032109
AA Change: E822*

DomainStartEndE-ValueType
Pfam:NACHT 160 325 1.3e-23 PFAM
low complexity region 543 556 N/A INTRINSIC
LRR 695 722 1.66e2 SMART
LRR 749 776 3.59e1 SMART
LRR 778 805 6.23e-2 SMART
LRR 806 833 1.13e0 SMART
LRR 834 861 1.99e1 SMART
LRR 862 885 8.11e1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000169651
AA Change: E822*
SMART Domains Protein: ENSMUSP00000126555
Gene: ENSMUSG00000032109
AA Change: E822*

DomainStartEndE-ValueType
Pfam:NACHT 160 325 1.3e-23 PFAM
low complexity region 543 556 N/A INTRINSIC
LRR 695 722 1.66e2 SMART
LRR 749 776 3.59e1 SMART
LRR 778 805 6.23e-2 SMART
LRR 806 833 1.13e0 SMART
LRR 834 861 1.99e1 SMART
LRR 862 885 8.11e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213186
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215389
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 94.9%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the NLR family and localizes to the outer mitochondrial membrane. The encoded protein is a regulator of mitochondrial antivirus responses. Three transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to viral infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik A G 7: 118,833,748 N568S probably damaging Het
A2m C A 6: 121,654,612 L623M probably benign Het
Abhd2 T C 7: 79,348,356 I212T possibly damaging Het
Adam7 A C 14: 68,512,625 S449A possibly damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Aox3 T C 1: 58,180,651 Y1137H probably damaging Het
Atp11b T C 3: 35,834,325 Y715H probably damaging Het
Atrn A G 2: 130,995,051 Y1145C probably damaging Het
Btbd7 A G 12: 102,793,796 I631T probably benign Het
Cadps T C 14: 12,465,859 K1017R possibly damaging Het
Cfap45 A G 1: 172,545,112 E458G probably damaging Het
Cptp C T 4: 155,866,538 R157H probably damaging Het
Dcbld1 A C 10: 52,319,651 E318D possibly damaging Het
Ddr2 G T 1: 170,004,245 P197Q probably damaging Het
Dlg5 T C 14: 24,176,571 Y421C probably damaging Het
Dlgap2 A G 8: 14,843,624 K980E probably benign Het
Drc7 T C 8: 95,056,016 V3A unknown Het
Dst T C 1: 34,161,029 V96A probably damaging Het
Ect2l T C 10: 18,143,004 D548G possibly damaging Het
Efcab10 A T 12: 33,398,435 Y89F probably benign Het
Eif1ad CGAGGAGGAGGAGGAGGAGG CGAGGAGGAGGAGGAGG 19: 5,370,058 probably benign Het
Entpd6 A G 2: 150,758,812 T147A probably damaging Het
Fbxl5 T A 5: 43,765,490 E189D probably benign Het
Fer1l6 T A 15: 58,625,231 S1217T probably damaging Het
Frem2 A T 3: 53,653,495 V1197D possibly damaging Het
Fsip2 T A 2: 82,980,783 L2482* probably null Het
Fsip2 A T 2: 82,986,820 D4299V probably benign Het
Gipc3 T A 10: 81,338,215 I242F probably damaging Het
Hoxb1 T A 11: 96,366,112 Y96N probably damaging Het
Ibsp A G 5: 104,310,212 E205G probably damaging Het
Ibtk A G 9: 85,703,082 S1170P probably benign Het
Igfn1 A G 1: 135,966,063 probably null Het
Iqsec1 A G 6: 90,662,895 S954P probably benign Het
Kalrn A T 16: 34,392,093 D28E probably benign Het
Lrmda T C 14: 22,577,870 F52L probably damaging Het
Lrp2 T C 2: 69,523,287 D543G probably damaging Het
Lrrtm3 T C 10: 64,088,378 T337A probably benign Het
Marf1 C T 16: 14,128,601 D1219N possibly damaging Het
Mkln1 A G 6: 31,428,178 K118R probably benign Het
Nedd4l T C 18: 65,167,575 probably null Het
Neu2 A G 1: 87,597,301 E336G probably benign Het
Nfasc A G 1: 132,610,805 F448S probably damaging Het
Nr5a1 T C 2: 38,694,096 Y437C probably damaging Het
Olfr1224-ps1 A G 2: 89,156,581 V198A probably benign Het
Olfr1353 T A 10: 78,970,141 L164* probably null Het
Olfr885 T C 9: 38,061,685 Y122H probably damaging Het
Phtf1 C T 3: 103,969,122 Q13* probably null Het
Pnldc1 A G 17: 12,888,928 L525P possibly damaging Het
Ppl T A 16: 5,106,124 D162V possibly damaging Het
Prkdc T A 16: 15,714,215 S1448T possibly damaging Het
Ptgdr A G 14: 44,853,281 I340T probably benign Het
Recql T C 6: 142,365,589 I458M probably benign Het
Rrbp1 A T 2: 143,988,291 V652E probably benign Het
Rtp1 T A 16: 23,431,410 I175N probably damaging Het
Ryr1 A G 7: 29,054,944 M3523T probably damaging Het
S100a16 T C 3: 90,542,396 L62P probably damaging Het
Samd11 T C 4: 156,248,709 E364G probably damaging Het
Satb1 C A 17: 51,742,115 G603* probably null Het
Shroom3 T A 5: 92,962,365 probably null Het
Slc25a15 A G 8: 22,395,761 S3P probably benign Het
Socs2 A T 10: 95,413,038 L71* probably null Het
Sptbn1 T C 11: 30,104,469 E2208G probably damaging Het
St14 A G 9: 31,089,870 V855A possibly damaging Het
Susd1 T A 4: 59,412,191 T121S probably benign Het
Svs3b A T 2: 164,255,928 S158T probably benign Het
Synpo C T 18: 60,603,589 M428I probably benign Het
Syt10 C T 15: 89,790,776 D456N probably damaging Het
Taar4 A G 10: 23,961,341 D283G probably damaging Het
Tango6 T A 8: 106,688,794 D82E probably benign Het
Tcof1 T C 18: 60,838,855 T127A possibly damaging Het
Tle3 G A 9: 61,411,340 probably null Het
Tmem45a A G 16: 56,822,302 F169L probably benign Het
Trp53rkb T A 2: 166,795,823 V233E probably damaging Het
Ttc7b C T 12: 100,415,130 probably null Het
Tubgcp3 A T 8: 12,621,932 L770* probably null Het
Tut1 G A 19: 8,966,102 G851D probably benign Het
Ubr1 G A 2: 120,930,968 T576I probably benign Het
Vmn1r125 T A 7: 21,272,605 Y143N probably damaging Het
Vmn2r120 T A 17: 57,524,839 I317F probably benign Het
Vmn2r95 T A 17: 18,424,313 N70K probably benign Het
Wdr59 A T 8: 111,486,950 L311* probably null Het
Wnt2 A G 6: 18,030,253 L12P unknown Het
Xrn1 T C 9: 95,999,497 I700T probably benign Het
Ypel1 A G 16: 17,082,579 H98R probably benign Het
Zfp219 T C 14: 52,008,234 T434A probably benign Het
Zik1 A C 7: 10,490,016 C385G probably damaging Het
Other mutations in Nlrx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Nlrx1 APN 9 44253279 missense probably damaging 0.96
IGL00233:Nlrx1 APN 9 44264068 missense probably benign 0.37
IGL02388:Nlrx1 APN 9 44264005 missense probably benign 0.09
IGL02450:Nlrx1 APN 9 44253501 missense probably benign
IGL03353:Nlrx1 APN 9 44256593 missense probably benign
R0180:Nlrx1 UTSW 9 44255459 missense possibly damaging 0.95
R0416:Nlrx1 UTSW 9 44262914 missense probably benign
R1478:Nlrx1 UTSW 9 44264077 missense probably benign 0.04
R1762:Nlrx1 UTSW 9 44263640 missense possibly damaging 0.49
R1972:Nlrx1 UTSW 9 44253456 missense probably benign 0.01
R2050:Nlrx1 UTSW 9 44262780 missense probably damaging 1.00
R2100:Nlrx1 UTSW 9 44262608 missense probably damaging 1.00
R3967:Nlrx1 UTSW 9 44255425 splice site probably benign
R3968:Nlrx1 UTSW 9 44255425 splice site probably benign
R3969:Nlrx1 UTSW 9 44255425 splice site probably benign
R4898:Nlrx1 UTSW 9 44256897 missense probably benign
R4951:Nlrx1 UTSW 9 44253429 missense possibly damaging 0.81
R4956:Nlrx1 UTSW 9 44262612 nonsense probably null
R4959:Nlrx1 UTSW 9 44254151 missense possibly damaging 0.79
R5235:Nlrx1 UTSW 9 44263750 missense probably damaging 0.99
R5536:Nlrx1 UTSW 9 44263886 missense probably damaging 1.00
R6030:Nlrx1 UTSW 9 44263760 missense probably damaging 1.00
R6030:Nlrx1 UTSW 9 44263760 missense probably damaging 1.00
R6698:Nlrx1 UTSW 9 44265807 missense probably damaging 1.00
R7130:Nlrx1 UTSW 9 44262341 missense possibly damaging 0.83
R7253:Nlrx1 UTSW 9 44264704 splice site probably null
R7457:Nlrx1 UTSW 9 44256510 missense probably benign 0.28
R7863:Nlrx1 UTSW 9 44265212 missense probably benign
R7937:Nlrx1 UTSW 9 44264789 missense probably damaging 1.00
X0023:Nlrx1 UTSW 9 44256563 missense probably damaging 1.00
Z1176:Nlrx1 UTSW 9 44256923 missense possibly damaging 0.51
Z1177:Nlrx1 UTSW 9 44256752 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- AGAGTAGGTTCATGCCACCC -3'
(R):5'- CAACGTCCTAACACCCAGTTTG -3'

Sequencing Primer
(F):5'- CCCCCAGGGTAGGAAGAAC -3'
(R):5'- CTTAGGCTCTCCAACAAC -3'
Posted On2014-07-14