Incidental Mutation 'R1921:Socs2'
ID213080
Institutional Source Beutler Lab
Gene Symbol Socs2
Ensembl Gene ENSMUSG00000020027
Gene Namesuppressor of cytokine signaling 2
SynonymsCIS2, D130043N08Rik, cytokine-inducible SH2 protein 2, STAT-induced STAT inhibitor 2, Cish2, SOCS-2, JAB, SSI-2
MMRRC Submission 039939-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.243) question?
Stock #R1921 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location95385362-95417180 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 95413038 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 71 (L71*)
Ref Sequence ENSEMBL: ENSMUSP00000131875 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020215] [ENSMUST00000119917] [ENSMUST00000129942] [ENSMUST00000135822] [ENSMUST00000150432] [ENSMUST00000170690] [ENSMUST00000172070]
Predicted Effect probably null
Transcript: ENSMUST00000020215
AA Change: L71*
SMART Domains Protein: ENSMUSP00000020215
Gene: ENSMUSG00000020027
AA Change: L71*

DomainStartEndE-ValueType
low complexity region 32 43 N/A INTRINSIC
SH2 46 135 5.22e-22 SMART
SOCS 154 195 3.15e-16 SMART
SOCS_box 160 194 1.06e-9 SMART
Predicted Effect probably null
Transcript: ENSMUST00000119917
AA Change: L71*
SMART Domains Protein: ENSMUSP00000113378
Gene: ENSMUSG00000020027
AA Change: L71*

DomainStartEndE-ValueType
low complexity region 32 43 N/A INTRINSIC
SH2 46 135 5.22e-22 SMART
SOCS 154 195 3.15e-16 SMART
SOCS_box 160 194 1.06e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128363
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128854
Predicted Effect probably benign
Transcript: ENSMUST00000129942
SMART Domains Protein: ENSMUSP00000117576
Gene: ENSMUSG00000020027

DomainStartEndE-ValueType
SCOP:d1a81a2 30 62 8e-4 SMART
PDB:4JGH|A 45 62 7e-6 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134918
Predicted Effect probably null
Transcript: ENSMUST00000135822
AA Change: L71*
SMART Domains Protein: ENSMUSP00000118720
Gene: ENSMUSG00000020027
AA Change: L71*

DomainStartEndE-ValueType
low complexity region 32 43 N/A INTRINSIC
Pfam:SH2 48 80 1.9e-8 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000139210
AA Change: L24*
SMART Domains Protein: ENSMUSP00000121305
Gene: ENSMUSG00000020027
AA Change: L24*

DomainStartEndE-ValueType
SH2 1 89 5.07e-20 SMART
SOCS 108 149 3.15e-16 SMART
SOCS_box 114 148 1.06e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145847
Predicted Effect silent
Transcript: ENSMUST00000150432
SMART Domains Protein: ENSMUSP00000117785
Gene: ENSMUSG00000020027

DomainStartEndE-ValueType
SCOP:d1bg1a3 40 70 3e-7 SMART
PDB:2C9W|A 45 70 5e-12 PDB
Blast:SH2 46 70 8e-11 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155148
Predicted Effect probably null
Transcript: ENSMUST00000170690
AA Change: L71*
SMART Domains Protein: ENSMUSP00000129331
Gene: ENSMUSG00000020027
AA Change: L71*

DomainStartEndE-ValueType
low complexity region 32 43 N/A INTRINSIC
SH2 46 135 5.22e-22 SMART
SOCS 154 195 3.15e-16 SMART
SOCS_box 160 194 1.06e-9 SMART
Predicted Effect probably null
Transcript: ENSMUST00000172070
AA Change: L71*
SMART Domains Protein: ENSMUSP00000131875
Gene: ENSMUSG00000020027
AA Change: L71*

DomainStartEndE-ValueType
low complexity region 32 43 N/A INTRINSIC
SH2 46 135 5.22e-22 SMART
SOCS 154 195 3.15e-16 SMART
SOCS_box 160 194 1.06e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181781
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 94.9%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the suppressor of cytokine signaling (SOCS) family. SOCS family members are cytokine-inducible negative regulators of cytokine receptor signaling via the Janus kinase/signal transducer and activation of transcription pathway (the JAK/STAT pathway). SOCS family proteins interact with major molecules of signaling complexes to block further signal transduction, in part, by proteasomal depletion of receptors or signal-transducing proteins via ubiquitination. The expression of this gene can be induced by a subset of cytokines, including erythropoietin, GM-CSF, IL10, interferon (IFN)-gamma and by cytokine receptors such as growth horomone receptor. The protein encoded by this gene interacts with the cytoplasmic domain of insulin-like growth factor-1 receptor (IGF1R) and is thought to be involved in the regulation of IGF1R mediated cell signaling. This gene has pseudogenes on chromosomes 20 and 22. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mutations in this gene cause accelerated postnatal growth. Homozygotes for a targeted mutation also show increased bone growth, enlargement of most organs, collagen deposition in the skin and some ducts and vessels, lower major urinary protein levels, and elevated IGF-I mRNA levels in some tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik A G 7: 118,833,748 N568S probably damaging Het
A2m C A 6: 121,654,612 L623M probably benign Het
Abhd2 T C 7: 79,348,356 I212T possibly damaging Het
Adam7 A C 14: 68,512,625 S449A possibly damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Aox3 T C 1: 58,180,651 Y1137H probably damaging Het
Atp11b T C 3: 35,834,325 Y715H probably damaging Het
Atrn A G 2: 130,995,051 Y1145C probably damaging Het
Btbd7 A G 12: 102,793,796 I631T probably benign Het
Cadps T C 14: 12,465,859 K1017R possibly damaging Het
Cfap45 A G 1: 172,545,112 E458G probably damaging Het
Cptp C T 4: 155,866,538 R157H probably damaging Het
Dcbld1 A C 10: 52,319,651 E318D possibly damaging Het
Ddr2 G T 1: 170,004,245 P197Q probably damaging Het
Dlg5 T C 14: 24,176,571 Y421C probably damaging Het
Dlgap2 A G 8: 14,843,624 K980E probably benign Het
Drc7 T C 8: 95,056,016 V3A unknown Het
Dst T C 1: 34,161,029 V96A probably damaging Het
Ect2l T C 10: 18,143,004 D548G possibly damaging Het
Efcab10 A T 12: 33,398,435 Y89F probably benign Het
Eif1ad CGAGGAGGAGGAGGAGGAGG CGAGGAGGAGGAGGAGG 19: 5,370,058 probably benign Het
Entpd6 A G 2: 150,758,812 T147A probably damaging Het
Fbxl5 T A 5: 43,765,490 E189D probably benign Het
Fer1l6 T A 15: 58,625,231 S1217T probably damaging Het
Frem2 A T 3: 53,653,495 V1197D possibly damaging Het
Fsip2 A T 2: 82,986,820 D4299V probably benign Het
Fsip2 T A 2: 82,980,783 L2482* probably null Het
Gipc3 T A 10: 81,338,215 I242F probably damaging Het
Hoxb1 T A 11: 96,366,112 Y96N probably damaging Het
Ibsp A G 5: 104,310,212 E205G probably damaging Het
Ibtk A G 9: 85,703,082 S1170P probably benign Het
Igfn1 A G 1: 135,966,063 probably null Het
Iqsec1 A G 6: 90,662,895 S954P probably benign Het
Kalrn A T 16: 34,392,093 D28E probably benign Het
Lrmda T C 14: 22,577,870 F52L probably damaging Het
Lrp2 T C 2: 69,523,287 D543G probably damaging Het
Lrrtm3 T C 10: 64,088,378 T337A probably benign Het
Marf1 C T 16: 14,128,601 D1219N possibly damaging Het
Mkln1 A G 6: 31,428,178 K118R probably benign Het
Nedd4l T C 18: 65,167,575 probably null Het
Neu2 A G 1: 87,597,301 E336G probably benign Het
Nfasc A G 1: 132,610,805 F448S probably damaging Het
Nlrx1 C A 9: 44,254,134 E822* probably null Het
Nr5a1 T C 2: 38,694,096 Y437C probably damaging Het
Olfr1224-ps1 A G 2: 89,156,581 V198A probably benign Het
Olfr1353 T A 10: 78,970,141 L164* probably null Het
Olfr885 T C 9: 38,061,685 Y122H probably damaging Het
Phtf1 C T 3: 103,969,122 Q13* probably null Het
Pnldc1 A G 17: 12,888,928 L525P possibly damaging Het
Ppl T A 16: 5,106,124 D162V possibly damaging Het
Prkdc T A 16: 15,714,215 S1448T possibly damaging Het
Ptgdr A G 14: 44,853,281 I340T probably benign Het
Recql T C 6: 142,365,589 I458M probably benign Het
Rrbp1 A T 2: 143,988,291 V652E probably benign Het
Rtp1 T A 16: 23,431,410 I175N probably damaging Het
Ryr1 A G 7: 29,054,944 M3523T probably damaging Het
S100a16 T C 3: 90,542,396 L62P probably damaging Het
Samd11 T C 4: 156,248,709 E364G probably damaging Het
Satb1 C A 17: 51,742,115 G603* probably null Het
Shroom3 T A 5: 92,962,365 probably null Het
Slc25a15 A G 8: 22,395,761 S3P probably benign Het
Sptbn1 T C 11: 30,104,469 E2208G probably damaging Het
St14 A G 9: 31,089,870 V855A possibly damaging Het
Susd1 T A 4: 59,412,191 T121S probably benign Het
Svs3b A T 2: 164,255,928 S158T probably benign Het
Synpo C T 18: 60,603,589 M428I probably benign Het
Syt10 C T 15: 89,790,776 D456N probably damaging Het
Taar4 A G 10: 23,961,341 D283G probably damaging Het
Tango6 T A 8: 106,688,794 D82E probably benign Het
Tcof1 T C 18: 60,838,855 T127A possibly damaging Het
Tle3 G A 9: 61,411,340 probably null Het
Tmem45a A G 16: 56,822,302 F169L probably benign Het
Trp53rkb T A 2: 166,795,823 V233E probably damaging Het
Ttc7b C T 12: 100,415,130 probably null Het
Tubgcp3 A T 8: 12,621,932 L770* probably null Het
Tut1 G A 19: 8,966,102 G851D probably benign Het
Ubr1 G A 2: 120,930,968 T576I probably benign Het
Vmn1r125 T A 7: 21,272,605 Y143N probably damaging Het
Vmn2r120 T A 17: 57,524,839 I317F probably benign Het
Vmn2r95 T A 17: 18,424,313 N70K probably benign Het
Wdr59 A T 8: 111,486,950 L311* probably null Het
Wnt2 A G 6: 18,030,253 L12P unknown Het
Xrn1 T C 9: 95,999,497 I700T probably benign Het
Ypel1 A G 16: 17,082,579 H98R probably benign Het
Zfp219 T C 14: 52,008,234 T434A probably benign Het
Zik1 A C 7: 10,490,016 C385G probably damaging Het
Other mutations in Socs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03064:Socs2 APN 10 95412851 nonsense probably null
samson UTSW 10 95413081 nonsense probably null
R1412:Socs2 UTSW 10 95414918 missense probably benign
R1617:Socs2 UTSW 10 95413081 nonsense probably null
R5261:Socs2 UTSW 10 95392819 missense unknown
R5638:Socs2 UTSW 10 95392883 missense unknown
R7689:Socs2 UTSW 10 95414983 start gained probably benign
R7957:Socs2 UTSW 10 95414950 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- AGGTGAACAGTCCCATTCCG -3'
(R):5'- ACCCAGAGATTTGTGGTAGGC -3'

Sequencing Primer
(F):5'- CCTTGCACATCTGGACATAGTAG -3'
(R):5'- GAAAAACCCCAGGATGGT -3'
Posted On2014-07-14