Incidental Mutation 'R1921:Sptbn1'
ID213081
Institutional Source Beutler Lab
Gene Symbol Sptbn1
Ensembl Gene ENSMUSG00000020315
Gene Namespectrin beta, non-erythrocytic 1
Synonymsnon-erythrocytic, Spnb-2, elf3, 9930031C03Rik, elf1, beta fodrin, brain spectrin, spectrin G, Spnb2
MMRRC Submission 039939-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1921 (G1)
Quality Score202
Status Not validated
Chromosome11
Chromosomal Location30099395-30268175 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30104469 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 2208 (E2208G)
Ref Sequence ENSEMBL: ENSMUSP00000011877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006629] [ENSMUST00000011877] [ENSMUST00000102838]
Predicted Effect probably damaging
Transcript: ENSMUST00000006629
AA Change: E2208G

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000006629
Gene: ENSMUSG00000020315
AA Change: E2208G

DomainStartEndE-ValueType
low complexity region 20 34 N/A INTRINSIC
CH 56 156 3.02e-28 SMART
CH 175 273 8.73e-25 SMART
SPEC 305 411 2.03e0 SMART
SPEC 425 525 6.42e-26 SMART
SPEC 531 635 4.61e-27 SMART
SPEC 641 741 2.36e-33 SMART
SPEC 747 846 1.2e-25 SMART
SPEC 852 952 7.16e-24 SMART
SPEC 958 1059 6.58e-23 SMART
SPEC 1065 1166 1.79e-24 SMART
SPEC 1172 1272 2.2e-24 SMART
SPEC 1278 1377 5.18e-21 SMART
SPEC 1383 1482 1.02e-19 SMART
SPEC 1488 1589 7.2e-29 SMART
SPEC 1595 1695 8.03e-27 SMART
SPEC 1701 1802 9.73e-26 SMART
SPEC 1808 1908 9.82e-22 SMART
SPEC 1914 2014 8.68e-23 SMART
SPEC 2020 2162 3.1e-10 SMART
PH 2197 2308 1.64e-18 SMART
low complexity region 2312 2327 N/A INTRINSIC
low complexity region 2343 2355 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000011877
AA Change: E2208G

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000011877
Gene: ENSMUSG00000020315
AA Change: E2208G

DomainStartEndE-ValueType
low complexity region 20 34 N/A INTRINSIC
CH 56 156 3.02e-28 SMART
CH 175 273 8.73e-25 SMART
SPEC 305 411 2.03e0 SMART
SPEC 425 525 6.42e-26 SMART
SPEC 531 635 4.61e-27 SMART
SPEC 641 741 2.36e-33 SMART
SPEC 747 846 1.2e-25 SMART
SPEC 852 952 7.16e-24 SMART
SPEC 958 1059 6.58e-23 SMART
SPEC 1065 1166 1.79e-24 SMART
SPEC 1172 1272 2.2e-24 SMART
SPEC 1278 1377 5.18e-21 SMART
SPEC 1383 1482 1.02e-19 SMART
SPEC 1488 1589 7.2e-29 SMART
SPEC 1595 1695 8.03e-27 SMART
SPEC 1701 1802 9.73e-26 SMART
SPEC 1808 1908 9.82e-22 SMART
SPEC 1914 2014 8.68e-23 SMART
SPEC 2020 2162 3.1e-10 SMART
PH 2197 2308 1.64e-18 SMART
low complexity region 2312 2327 N/A INTRINSIC
low complexity region 2343 2355 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102838
SMART Domains Protein: ENSMUSP00000099902
Gene: ENSMUSG00000020315

DomainStartEndE-ValueType
CH 43 143 3.02e-28 SMART
CH 162 260 8.73e-25 SMART
SPEC 292 398 2.03e0 SMART
SPEC 412 512 6.42e-26 SMART
SPEC 518 622 4.61e-27 SMART
SPEC 628 728 2.36e-33 SMART
SPEC 734 833 1.2e-25 SMART
SPEC 839 939 7.16e-24 SMART
SPEC 945 1046 6.58e-23 SMART
SPEC 1052 1153 1.79e-24 SMART
SPEC 1159 1259 2.2e-24 SMART
SPEC 1265 1364 5.18e-21 SMART
SPEC 1370 1469 1.02e-19 SMART
SPEC 1475 1576 7.2e-29 SMART
SPEC 1582 1682 8.03e-27 SMART
SPEC 1688 1789 9.73e-26 SMART
SPEC 1795 1895 9.82e-22 SMART
SPEC 1901 2001 8.68e-23 SMART
SPEC 2007 2114 2.66e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133466
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145315
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186216
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 94.9%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrin is an actin crosslinking and molecular scaffold protein that links the plasma membrane to the actin cytoskeleton, and functions in the determination of cell shape, arrangement of transmembrane proteins, and organization of organelles. It is composed of two antiparallel dimers of alpha- and beta- subunits. This gene is one member of a family of beta-spectrin genes. The encoded protein contains an N-terminal actin-binding domain, and 17 spectrin repeats which are involved in dimer formation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to mid-gestational lethality due to gastrointestinal, liver, neural, and cardiac defects, whereas heterozygotes survive until adulthood and spontaneously develop cancers in several organs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik A G 7: 118,833,748 N568S probably damaging Het
A2m C A 6: 121,654,612 L623M probably benign Het
Abhd2 T C 7: 79,348,356 I212T possibly damaging Het
Adam7 A C 14: 68,512,625 S449A possibly damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Aox3 T C 1: 58,180,651 Y1137H probably damaging Het
Atp11b T C 3: 35,834,325 Y715H probably damaging Het
Atrn A G 2: 130,995,051 Y1145C probably damaging Het
Btbd7 A G 12: 102,793,796 I631T probably benign Het
Cadps T C 14: 12,465,859 K1017R possibly damaging Het
Cfap45 A G 1: 172,545,112 E458G probably damaging Het
Cptp C T 4: 155,866,538 R157H probably damaging Het
Dcbld1 A C 10: 52,319,651 E318D possibly damaging Het
Ddr2 G T 1: 170,004,245 P197Q probably damaging Het
Dlg5 T C 14: 24,176,571 Y421C probably damaging Het
Dlgap2 A G 8: 14,843,624 K980E probably benign Het
Drc7 T C 8: 95,056,016 V3A unknown Het
Dst T C 1: 34,161,029 V96A probably damaging Het
Ect2l T C 10: 18,143,004 D548G possibly damaging Het
Efcab10 A T 12: 33,398,435 Y89F probably benign Het
Eif1ad CGAGGAGGAGGAGGAGGAGG CGAGGAGGAGGAGGAGG 19: 5,370,058 probably benign Het
Entpd6 A G 2: 150,758,812 T147A probably damaging Het
Fbxl5 T A 5: 43,765,490 E189D probably benign Het
Fer1l6 T A 15: 58,625,231 S1217T probably damaging Het
Frem2 A T 3: 53,653,495 V1197D possibly damaging Het
Fsip2 T A 2: 82,980,783 L2482* probably null Het
Fsip2 A T 2: 82,986,820 D4299V probably benign Het
Gipc3 T A 10: 81,338,215 I242F probably damaging Het
Hoxb1 T A 11: 96,366,112 Y96N probably damaging Het
Ibsp A G 5: 104,310,212 E205G probably damaging Het
Ibtk A G 9: 85,703,082 S1170P probably benign Het
Igfn1 A G 1: 135,966,063 probably null Het
Iqsec1 A G 6: 90,662,895 S954P probably benign Het
Kalrn A T 16: 34,392,093 D28E probably benign Het
Lrmda T C 14: 22,577,870 F52L probably damaging Het
Lrp2 T C 2: 69,523,287 D543G probably damaging Het
Lrrtm3 T C 10: 64,088,378 T337A probably benign Het
Marf1 C T 16: 14,128,601 D1219N possibly damaging Het
Mkln1 A G 6: 31,428,178 K118R probably benign Het
Nedd4l T C 18: 65,167,575 probably null Het
Neu2 A G 1: 87,597,301 E336G probably benign Het
Nfasc A G 1: 132,610,805 F448S probably damaging Het
Nlrx1 C A 9: 44,254,134 E822* probably null Het
Nr5a1 T C 2: 38,694,096 Y437C probably damaging Het
Olfr1224-ps1 A G 2: 89,156,581 V198A probably benign Het
Olfr1353 T A 10: 78,970,141 L164* probably null Het
Olfr885 T C 9: 38,061,685 Y122H probably damaging Het
Phtf1 C T 3: 103,969,122 Q13* probably null Het
Pnldc1 A G 17: 12,888,928 L525P possibly damaging Het
Ppl T A 16: 5,106,124 D162V possibly damaging Het
Prkdc T A 16: 15,714,215 S1448T possibly damaging Het
Ptgdr A G 14: 44,853,281 I340T probably benign Het
Recql T C 6: 142,365,589 I458M probably benign Het
Rrbp1 A T 2: 143,988,291 V652E probably benign Het
Rtp1 T A 16: 23,431,410 I175N probably damaging Het
Ryr1 A G 7: 29,054,944 M3523T probably damaging Het
S100a16 T C 3: 90,542,396 L62P probably damaging Het
Samd11 T C 4: 156,248,709 E364G probably damaging Het
Satb1 C A 17: 51,742,115 G603* probably null Het
Shroom3 T A 5: 92,962,365 probably null Het
Slc25a15 A G 8: 22,395,761 S3P probably benign Het
Socs2 A T 10: 95,413,038 L71* probably null Het
St14 A G 9: 31,089,870 V855A possibly damaging Het
Susd1 T A 4: 59,412,191 T121S probably benign Het
Svs3b A T 2: 164,255,928 S158T probably benign Het
Synpo C T 18: 60,603,589 M428I probably benign Het
Syt10 C T 15: 89,790,776 D456N probably damaging Het
Taar4 A G 10: 23,961,341 D283G probably damaging Het
Tango6 T A 8: 106,688,794 D82E probably benign Het
Tcof1 T C 18: 60,838,855 T127A possibly damaging Het
Tle3 G A 9: 61,411,340 probably null Het
Tmem45a A G 16: 56,822,302 F169L probably benign Het
Trp53rkb T A 2: 166,795,823 V233E probably damaging Het
Ttc7b C T 12: 100,415,130 probably null Het
Tubgcp3 A T 8: 12,621,932 L770* probably null Het
Tut1 G A 19: 8,966,102 G851D probably benign Het
Ubr1 G A 2: 120,930,968 T576I probably benign Het
Vmn1r125 T A 7: 21,272,605 Y143N probably damaging Het
Vmn2r120 T A 17: 57,524,839 I317F probably benign Het
Vmn2r95 T A 17: 18,424,313 N70K probably benign Het
Wdr59 A T 8: 111,486,950 L311* probably null Het
Wnt2 A G 6: 18,030,253 L12P unknown Het
Xrn1 T C 9: 95,999,497 I700T probably benign Het
Ypel1 A G 16: 17,082,579 H98R probably benign Het
Zfp219 T C 14: 52,008,234 T434A probably benign Het
Zik1 A C 7: 10,490,016 C385G probably damaging Het
Other mutations in Sptbn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Sptbn1 APN 11 30110818 nonsense probably null
IGL01098:Sptbn1 APN 11 30159385 missense probably damaging 1.00
IGL01843:Sptbn1 APN 11 30104623 missense probably benign 0.02
IGL02070:Sptbn1 APN 11 30145979 missense probably damaging 0.99
IGL02075:Sptbn1 APN 11 30138496 missense probably damaging 1.00
IGL02094:Sptbn1 APN 11 30100659 missense probably benign 0.01
IGL02102:Sptbn1 APN 11 30137427 missense probably damaging 1.00
IGL02189:Sptbn1 APN 11 30117871 missense probably damaging 1.00
IGL02256:Sptbn1 APN 11 30120990 missense probably benign 0.24
IGL02301:Sptbn1 APN 11 30142129 missense probably damaging 1.00
IGL02354:Sptbn1 APN 11 30110783 missense probably damaging 1.00
IGL02361:Sptbn1 APN 11 30110783 missense probably damaging 1.00
IGL02377:Sptbn1 APN 11 30119491 missense possibly damaging 0.92
IGL02504:Sptbn1 APN 11 30142293 missense probably damaging 1.00
IGL02672:Sptbn1 APN 11 30137239 missense probably damaging 1.00
IGL02733:Sptbn1 APN 11 30197747 missense probably benign 0.12
IGL02755:Sptbn1 APN 11 30142247 missense probably damaging 1.00
R0006:Sptbn1 UTSW 11 30123855 missense probably damaging 1.00
R0006:Sptbn1 UTSW 11 30123855 missense probably damaging 1.00
R0096:Sptbn1 UTSW 11 30114739 missense probably damaging 1.00
R0139:Sptbn1 UTSW 11 30142289 missense probably benign 0.00
R0370:Sptbn1 UTSW 11 30121545 missense probably benign
R0389:Sptbn1 UTSW 11 30139250 missense possibly damaging 0.95
R0415:Sptbn1 UTSW 11 30149576 missense probably damaging 1.00
R0552:Sptbn1 UTSW 11 30145985 missense possibly damaging 0.92
R0601:Sptbn1 UTSW 11 30150008 missense probably damaging 1.00
R0609:Sptbn1 UTSW 11 30138979 missense probably damaging 1.00
R0675:Sptbn1 UTSW 11 30117903 missense probably damaging 1.00
R0708:Sptbn1 UTSW 11 30114739 missense probably damaging 1.00
R0711:Sptbn1 UTSW 11 30114739 missense probably damaging 1.00
R0729:Sptbn1 UTSW 11 30110902 missense probably damaging 0.96
R0755:Sptbn1 UTSW 11 30139016 missense probably damaging 1.00
R0892:Sptbn1 UTSW 11 30142201 missense probably damaging 1.00
R0927:Sptbn1 UTSW 11 30121591 missense probably damaging 1.00
R1102:Sptbn1 UTSW 11 30120785 missense possibly damaging 0.93
R1460:Sptbn1 UTSW 11 30138637 missense possibly damaging 0.50
R1479:Sptbn1 UTSW 11 30113909 missense probably damaging 1.00
R1496:Sptbn1 UTSW 11 30121498 missense probably damaging 1.00
R1649:Sptbn1 UTSW 11 30137301 missense probably damaging 0.97
R1663:Sptbn1 UTSW 11 30120783 missense possibly damaging 0.53
R1671:Sptbn1 UTSW 11 30142245 missense possibly damaging 0.57
R1680:Sptbn1 UTSW 11 30159371 missense possibly damaging 0.92
R1695:Sptbn1 UTSW 11 30136124 missense probably benign 0.13
R1868:Sptbn1 UTSW 11 30114781 missense possibly damaging 0.70
R1918:Sptbn1 UTSW 11 30142414 missense probably damaging 1.00
R2026:Sptbn1 UTSW 11 30104559 missense probably benign 0.02
R2038:Sptbn1 UTSW 11 30159293 critical splice donor site probably null
R2047:Sptbn1 UTSW 11 30138360 splice site probably benign
R2312:Sptbn1 UTSW 11 30154249 missense probably damaging 1.00
R3430:Sptbn1 UTSW 11 30219686 missense possibly damaging 0.67
R3624:Sptbn1 UTSW 11 30140593 missense probably damaging 1.00
R3723:Sptbn1 UTSW 11 30137335 missense possibly damaging 0.59
R3862:Sptbn1 UTSW 11 30142329 missense possibly damaging 0.63
R4446:Sptbn1 UTSW 11 30139114 missense possibly damaging 0.70
R4582:Sptbn1 UTSW 11 30219597 missense probably damaging 1.00
R4705:Sptbn1 UTSW 11 30100660 missense probably benign
R4707:Sptbn1 UTSW 11 30137197 missense possibly damaging 0.61
R4718:Sptbn1 UTSW 11 30154297 missense probably damaging 1.00
R4789:Sptbn1 UTSW 11 30117759 missense probably benign
R4824:Sptbn1 UTSW 11 30118295 missense possibly damaging 0.72
R4855:Sptbn1 UTSW 11 30142353 missense probably damaging 1.00
R5009:Sptbn1 UTSW 11 30124016 missense probably benign 0.05
R5071:Sptbn1 UTSW 11 30113854 critical splice donor site probably null
R5153:Sptbn1 UTSW 11 30121510 missense possibly damaging 0.82
R5334:Sptbn1 UTSW 11 30137364 missense possibly damaging 0.92
R5462:Sptbn1 UTSW 11 30100520 missense possibly damaging 0.94
R5523:Sptbn1 UTSW 11 30137560 missense probably damaging 1.00
R5707:Sptbn1 UTSW 11 30143174 missense possibly damaging 0.65
R5724:Sptbn1 UTSW 11 30144113 missense possibly damaging 0.91
R5738:Sptbn1 UTSW 11 30145941 missense probably damaging 1.00
R5864:Sptbn1 UTSW 11 30145925 missense probably damaging 1.00
R5895:Sptbn1 UTSW 11 30123978 missense probably damaging 0.99
R5932:Sptbn1 UTSW 11 30136136 missense probably damaging 1.00
R5966:Sptbn1 UTSW 11 30124873 missense probably damaging 1.00
R5984:Sptbn1 UTSW 11 30118464 missense probably damaging 1.00
R6155:Sptbn1 UTSW 11 30137403 missense probably damaging 0.99
R6163:Sptbn1 UTSW 11 30159443 nonsense probably null
R6226:Sptbn1 UTSW 11 30136054 missense probably damaging 1.00
R6271:Sptbn1 UTSW 11 30100660 missense probably benign 0.00
R6443:Sptbn1 UTSW 11 30139429 missense possibly damaging 0.56
R6591:Sptbn1 UTSW 11 30113984 missense probably damaging 0.99
R6616:Sptbn1 UTSW 11 30124030 missense probably benign 0.08
R6691:Sptbn1 UTSW 11 30113984 missense probably damaging 0.99
R6751:Sptbn1 UTSW 11 30117859 missense probably damaging 1.00
R6823:Sptbn1 UTSW 11 30114787 missense probably damaging 1.00
R6863:Sptbn1 UTSW 11 30146777 missense possibly damaging 0.94
R6885:Sptbn1 UTSW 11 30138634 missense probably benign 0.26
R6892:Sptbn1 UTSW 11 30142187 missense probably benign 0.27
R6998:Sptbn1 UTSW 11 30100633 missense probably damaging 0.97
R7043:Sptbn1 UTSW 11 30103323 missense probably benign 0.02
R7092:Sptbn1 UTSW 11 30137119 missense possibly damaging 0.75
R7272:Sptbn1 UTSW 11 30114859 missense possibly damaging 0.93
R7301:Sptbn1 UTSW 11 30117798 nonsense probably null
R7379:Sptbn1 UTSW 11 30139292 missense possibly damaging 0.72
R7774:Sptbn1 UTSW 11 30142142 missense probably damaging 0.99
R7813:Sptbn1 UTSW 11 30138455 missense probably damaging 1.00
R7837:Sptbn1 UTSW 11 30138832 missense probably damaging 1.00
R7843:Sptbn1 UTSW 11 30154320 missense probably damaging 1.00
R7846:Sptbn1 UTSW 11 30142153 missense probably damaging 0.98
R7877:Sptbn1 UTSW 11 30129601 missense possibly damaging 0.94
R7902:Sptbn1 UTSW 11 30136048 missense probably damaging 1.00
R8060:Sptbn1 UTSW 11 30101616 missense probably damaging 0.99
R8116:Sptbn1 UTSW 11 30139117 missense probably damaging 1.00
R8169:Sptbn1 UTSW 11 30197783 missense possibly damaging 0.62
R8208:Sptbn1 UTSW 11 30124972 missense probably damaging 1.00
R8247:Sptbn1 UTSW 11 30113906 missense possibly damaging 0.84
R8412:Sptbn1 UTSW 11 30138457 missense probably damaging 1.00
Z1176:Sptbn1 UTSW 11 30137439 missense probably damaging 1.00
Z1176:Sptbn1 UTSW 11 30197787 missense probably benign 0.13
Z1177:Sptbn1 UTSW 11 30114734 missense probably damaging 1.00
Z1177:Sptbn1 UTSW 11 30120659 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- TACATCTCCTGAGCTGAGTGTC -3'
(R):5'- TGTCCCTAGATGGCAGGAAC -3'

Sequencing Primer
(F):5'- GAGCTGAGTGTCACTCTCAC -3'
(R):5'- TGAAATGGTCAACGGTGCTGC -3'
Posted On2014-07-14