Incidental Mutation 'R1921:Ppl'
ID213095
Institutional Source Beutler Lab
Gene Symbol Ppl
Ensembl Gene ENSMUSG00000039457
Gene Nameperiplakin
Synonyms
MMRRC Submission 039939-MU
Accession Numbers

Genbank: NM_008909

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1921 (G1)
Quality Score217
Status Not validated
Chromosome16
Chromosomal Location5086291-5132421 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 5106124 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 162 (D162V)
Ref Sequence ENSEMBL: ENSMUSP00000039360 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035672]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035672
AA Change: D162V

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000039360
Gene: ENSMUSG00000039457
AA Change: D162V

DomainStartEndE-ValueType
SPEC 123 211 1.58e0 SMART
SPEC 214 315 3.38e-2 SMART
SPEC 321 483 1.11e-2 SMART
SPEC 503 610 4.96e0 SMART
Blast:SPEC 613 717 5e-59 BLAST
low complexity region 718 729 N/A INTRINSIC
Blast:SPEC 732 859 2e-60 BLAST
low complexity region 893 908 N/A INTRINSIC
low complexity region 963 982 N/A INTRINSIC
internal_repeat_2 984 1004 3.46e-5 PROSPERO
internal_repeat_1 992 1008 8.09e-7 PROSPERO
low complexity region 1011 1020 N/A INTRINSIC
low complexity region 1027 1042 N/A INTRINSIC
internal_repeat_1 1112 1128 8.09e-7 PROSPERO
coiled coil region 1180 1279 N/A INTRINSIC
low complexity region 1346 1355 N/A INTRINSIC
low complexity region 1386 1433 N/A INTRINSIC
low complexity region 1455 1479 N/A INTRINSIC
Blast:SPEC 1529 1610 8e-30 BLAST
low complexity region 1612 1630 N/A INTRINSIC
PLEC 1649 1683 1.34e-5 SMART
PLEC 1698 1733 2.23e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230554
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 94.9%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of desmosomes and of the epidermal cornified envelope in keratinocytes. The N-terminal domain of this protein interacts with the plasma membrane and its C-terminus interacts with intermediate filaments. Through its rod domain, this protein forms complexes with envoplakin. This protein may serve as a link between the cornified envelope and desmosomes as well as intermediate filaments. AKT1/PKB, a protein kinase mediating a variety of cell growth and survival signaling processes, is reported to interact with this protein, suggesting a possible role for this protein as a localization signal in AKT1-mediated signaling. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are fertile and grossly normal with no apparent skin abnormalities. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik A G 7: 118,833,748 N568S probably damaging Het
A2m C A 6: 121,654,612 L623M probably benign Het
Abhd2 T C 7: 79,348,356 I212T possibly damaging Het
Adam7 A C 14: 68,512,625 S449A possibly damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Aox3 T C 1: 58,180,651 Y1137H probably damaging Het
Atp11b T C 3: 35,834,325 Y715H probably damaging Het
Atrn A G 2: 130,995,051 Y1145C probably damaging Het
Btbd7 A G 12: 102,793,796 I631T probably benign Het
Cadps T C 14: 12,465,859 K1017R possibly damaging Het
Cfap45 A G 1: 172,545,112 E458G probably damaging Het
Cptp C T 4: 155,866,538 R157H probably damaging Het
Dcbld1 A C 10: 52,319,651 E318D possibly damaging Het
Ddr2 G T 1: 170,004,245 P197Q probably damaging Het
Dlg5 T C 14: 24,176,571 Y421C probably damaging Het
Dlgap2 A G 8: 14,843,624 K980E probably benign Het
Drc7 T C 8: 95,056,016 V3A unknown Het
Dst T C 1: 34,161,029 V96A probably damaging Het
Ect2l T C 10: 18,143,004 D548G possibly damaging Het
Efcab10 A T 12: 33,398,435 Y89F probably benign Het
Eif1ad CGAGGAGGAGGAGGAGGAGG CGAGGAGGAGGAGGAGG 19: 5,370,058 probably benign Het
Entpd6 A G 2: 150,758,812 T147A probably damaging Het
Fbxl5 T A 5: 43,765,490 E189D probably benign Het
Fer1l6 T A 15: 58,625,231 S1217T probably damaging Het
Frem2 A T 3: 53,653,495 V1197D possibly damaging Het
Fsip2 T A 2: 82,980,783 L2482* probably null Het
Fsip2 A T 2: 82,986,820 D4299V probably benign Het
Gipc3 T A 10: 81,338,215 I242F probably damaging Het
Hoxb1 T A 11: 96,366,112 Y96N probably damaging Het
Ibsp A G 5: 104,310,212 E205G probably damaging Het
Ibtk A G 9: 85,703,082 S1170P probably benign Het
Igfn1 A G 1: 135,966,063 probably null Het
Iqsec1 A G 6: 90,662,895 S954P probably benign Het
Kalrn A T 16: 34,392,093 D28E probably benign Het
Lrmda T C 14: 22,577,870 F52L probably damaging Het
Lrp2 T C 2: 69,523,287 D543G probably damaging Het
Lrrtm3 T C 10: 64,088,378 T337A probably benign Het
Marf1 C T 16: 14,128,601 D1219N possibly damaging Het
Mkln1 A G 6: 31,428,178 K118R probably benign Het
Nedd4l T C 18: 65,167,575 probably null Het
Neu2 A G 1: 87,597,301 E336G probably benign Het
Nfasc A G 1: 132,610,805 F448S probably damaging Het
Nlrx1 C A 9: 44,254,134 E822* probably null Het
Nr5a1 T C 2: 38,694,096 Y437C probably damaging Het
Olfr1224-ps1 A G 2: 89,156,581 V198A probably benign Het
Olfr1353 T A 10: 78,970,141 L164* probably null Het
Olfr885 T C 9: 38,061,685 Y122H probably damaging Het
Phtf1 C T 3: 103,969,122 Q13* probably null Het
Pnldc1 A G 17: 12,888,928 L525P possibly damaging Het
Prkdc T A 16: 15,714,215 S1448T possibly damaging Het
Ptgdr A G 14: 44,853,281 I340T probably benign Het
Recql T C 6: 142,365,589 I458M probably benign Het
Rrbp1 A T 2: 143,988,291 V652E probably benign Het
Rtp1 T A 16: 23,431,410 I175N probably damaging Het
Ryr1 A G 7: 29,054,944 M3523T probably damaging Het
S100a16 T C 3: 90,542,396 L62P probably damaging Het
Samd11 T C 4: 156,248,709 E364G probably damaging Het
Satb1 C A 17: 51,742,115 G603* probably null Het
Shroom3 T A 5: 92,962,365 probably null Het
Slc25a15 A G 8: 22,395,761 S3P probably benign Het
Socs2 A T 10: 95,413,038 L71* probably null Het
Sptbn1 T C 11: 30,104,469 E2208G probably damaging Het
St14 A G 9: 31,089,870 V855A possibly damaging Het
Susd1 T A 4: 59,412,191 T121S probably benign Het
Svs3b A T 2: 164,255,928 S158T probably benign Het
Synpo C T 18: 60,603,589 M428I probably benign Het
Syt10 C T 15: 89,790,776 D456N probably damaging Het
Taar4 A G 10: 23,961,341 D283G probably damaging Het
Tango6 T A 8: 106,688,794 D82E probably benign Het
Tcof1 T C 18: 60,838,855 T127A possibly damaging Het
Tle3 G A 9: 61,411,340 probably null Het
Tmem45a A G 16: 56,822,302 F169L probably benign Het
Trp53rkb T A 2: 166,795,823 V233E probably damaging Het
Ttc7b C T 12: 100,415,130 probably null Het
Tubgcp3 A T 8: 12,621,932 L770* probably null Het
Tut1 G A 19: 8,966,102 G851D probably benign Het
Ubr1 G A 2: 120,930,968 T576I probably benign Het
Vmn1r125 T A 7: 21,272,605 Y143N probably damaging Het
Vmn2r120 T A 17: 57,524,839 I317F probably benign Het
Vmn2r95 T A 17: 18,424,313 N70K probably benign Het
Wdr59 A T 8: 111,486,950 L311* probably null Het
Wnt2 A G 6: 18,030,253 L12P unknown Het
Xrn1 T C 9: 95,999,497 I700T probably benign Het
Ypel1 A G 16: 17,082,579 H98R probably benign Het
Zfp219 T C 14: 52,008,234 T434A probably benign Het
Zik1 A C 7: 10,490,016 C385G probably damaging Het
Other mutations in Ppl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Ppl APN 16 5089545 missense probably benign 0.41
IGL00484:Ppl APN 16 5087952 missense probably benign 0.13
IGL00654:Ppl APN 16 5087308 missense possibly damaging 0.94
IGL00832:Ppl APN 16 5088975 missense probably damaging 1.00
IGL01104:Ppl APN 16 5094491 missense probably benign 0.01
IGL01327:Ppl APN 16 5087644 missense probably benign 0.19
IGL01644:Ppl APN 16 5091855 missense probably damaging 1.00
IGL01824:Ppl APN 16 5087889 missense probably damaging 1.00
IGL02071:Ppl APN 16 5113072 missense probably benign 0.04
IGL02085:Ppl APN 16 5089816 missense probably benign 0.09
IGL02282:Ppl APN 16 5101458 missense probably damaging 1.00
IGL02635:Ppl APN 16 5089767 missense probably benign 0.01
IGL02649:Ppl APN 16 5087463 missense probably damaging 1.00
IGL02888:Ppl APN 16 5100407 missense possibly damaging 0.89
IGL03305:Ppl APN 16 5093233 missense possibly damaging 0.62
G4846:Ppl UTSW 16 5087206 missense probably damaging 1.00
IGL03097:Ppl UTSW 16 5096726 missense probably damaging 0.98
R0759:Ppl UTSW 16 5089777 missense probably benign 0.00
R0786:Ppl UTSW 16 5089054 missense probably damaging 1.00
R1024:Ppl UTSW 16 5100000 missense probably damaging 1.00
R1498:Ppl UTSW 16 5104765 missense probably benign 0.05
R1544:Ppl UTSW 16 5102597 nonsense probably null
R1597:Ppl UTSW 16 5107574 missense probably benign 0.20
R1863:Ppl UTSW 16 5087980 missense possibly damaging 0.69
R2230:Ppl UTSW 16 5088981 missense possibly damaging 0.51
R2275:Ppl UTSW 16 5094552 missense probably benign 0.00
R2355:Ppl UTSW 16 5094497 missense probably benign 0.00
R3410:Ppl UTSW 16 5107517 missense possibly damaging 0.81
R3737:Ppl UTSW 16 5106857 missense probably benign
R3797:Ppl UTSW 16 5104550 splice site probably benign
R3968:Ppl UTSW 16 5100332 splice site probably null
R3970:Ppl UTSW 16 5100332 splice site probably null
R4034:Ppl UTSW 16 5106857 missense probably benign
R4583:Ppl UTSW 16 5104536 missense probably benign 0.02
R4639:Ppl UTSW 16 5089446 missense probably damaging 1.00
R4762:Ppl UTSW 16 5088982 missense probably benign 0.00
R4828:Ppl UTSW 16 5104926 missense probably damaging 1.00
R4869:Ppl UTSW 16 5104889 missense probably damaging 0.99
R4925:Ppl UTSW 16 5104982 missense probably damaging 1.00
R4983:Ppl UTSW 16 5088718 missense possibly damaging 0.75
R4984:Ppl UTSW 16 5087641 missense probably benign
R4997:Ppl UTSW 16 5089371 missense probably damaging 1.00
R5072:Ppl UTSW 16 5088878 missense probably benign 0.01
R5073:Ppl UTSW 16 5088878 missense probably benign 0.01
R5074:Ppl UTSW 16 5088878 missense probably benign 0.01
R5286:Ppl UTSW 16 5089123 nonsense probably null
R5398:Ppl UTSW 16 5104922 missense probably benign 0.00
R5448:Ppl UTSW 16 5107566 missense probably benign
R5664:Ppl UTSW 16 5106055 missense probably benign 0.00
R5873:Ppl UTSW 16 5106049 critical splice donor site probably null
R5918:Ppl UTSW 16 5104901 missense probably benign 0.00
R5951:Ppl UTSW 16 5088628 missense probably benign 0.25
R6038:Ppl UTSW 16 5102581 missense possibly damaging 0.94
R6038:Ppl UTSW 16 5102581 missense possibly damaging 0.94
R6088:Ppl UTSW 16 5104988 missense possibly damaging 0.73
R6149:Ppl UTSW 16 5107596 nonsense probably null
R6358:Ppl UTSW 16 5087929 nonsense probably null
R6379:Ppl UTSW 16 5097691 missense probably benign 0.02
R6468:Ppl UTSW 16 5092441 missense probably damaging 1.00
R6514:Ppl UTSW 16 5087317 missense probably damaging 1.00
R6528:Ppl UTSW 16 5087616 missense probably benign 0.00
R6703:Ppl UTSW 16 5089464 missense probably damaging 0.99
R6721:Ppl UTSW 16 5107469 missense probably damaging 0.97
R6811:Ppl UTSW 16 5089144 missense probably damaging 0.99
R6934:Ppl UTSW 16 5094509 missense probably benign 0.00
R7034:Ppl UTSW 16 5087502 missense probably benign 0.29
R7076:Ppl UTSW 16 5100119 missense probably damaging 1.00
R7300:Ppl UTSW 16 5102371 missense possibly damaging 0.87
R7349:Ppl UTSW 16 5104729 missense probably damaging 0.99
R7359:Ppl UTSW 16 5089341 missense possibly damaging 0.78
R7378:Ppl UTSW 16 5112996 missense possibly damaging 0.91
R7383:Ppl UTSW 16 5097971 missense probably damaging 1.00
R7389:Ppl UTSW 16 5106713 intron probably null
R7445:Ppl UTSW 16 5089068 missense probably damaging 1.00
R7687:Ppl UTSW 16 5097942 missense probably benign 0.00
R7752:Ppl UTSW 16 5102302 missense probably benign 0.09
R7827:Ppl UTSW 16 5087964 missense probably damaging 1.00
RF009:Ppl UTSW 16 5097931 missense probably benign 0.00
X0054:Ppl UTSW 16 5104902 missense probably benign 0.00
Z1088:Ppl UTSW 16 5089507 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GGAGTTCACTGTTCTGCTCC -3'
(R):5'- TCAGTGGTCCAGAGAGATGC -3'

Sequencing Primer
(F):5'- CACTGTTCTGCTCCTGTGGG -3'
(R):5'- GAGAGATGCCTGCCACTACTTAG -3'
Posted On2014-07-14