Incidental Mutation 'R1921:Tut1'
ID213110
Institutional Source Beutler Lab
Gene Symbol Tut1
Ensembl Gene ENSMUSG00000071645
Gene Nameterminal uridylyl transferase 1, U6 snRNA-specific
SynonymsPAPD2, Rbm21, 2700038E08Rik, TUTase6
MMRRC Submission 039939-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.571) question?
Stock #R1921 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location8953850-8966207 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 8966102 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 851 (G851D)
Ref Sequence ENSEMBL: ENSMUSP00000093958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052248] [ENSMUST00000096239]
Predicted Effect probably benign
Transcript: ENSMUST00000052248
SMART Domains Protein: ENSMUSP00000093955
Gene: ENSMUSG00000071644

DomainStartEndE-ValueType
Pfam:GST_N 2 81 1.5e-25 PFAM
Pfam:GST_N_3 6 83 1.4e-8 PFAM
Pfam:GST_C_3 88 194 8.3e-13 PFAM
Pfam:GST_C 106 198 4.5e-22 PFAM
Pfam:GST_C_2 125 191 8.6e-12 PFAM
low complexity region 238 262 N/A INTRINSIC
EF1G 275 381 3.63e-78 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000096239
AA Change: G851D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000093958
Gene: ENSMUSG00000071645
AA Change: G851D

DomainStartEndE-ValueType
ZnF_C2H2 16 40 1.53e-1 SMART
RRM 57 124 2.02e-10 SMART
SCOP:d1f5aa2 173 221 1e-3 SMART
low complexity region 242 258 N/A INTRINSIC
low complexity region 300 314 N/A INTRINSIC
low complexity region 324 347 N/A INTRINSIC
low complexity region 423 434 N/A INTRINSIC
Pfam:PAP_assoc 493 552 2.7e-8 PFAM
low complexity region 594 618 N/A INTRINSIC
low complexity region 767 782 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122932
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127480
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128626
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152076
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 94.9%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nucleotidyl transferase that functions as both a terminal uridylyltransferase and a nuclear poly(A) polymerase. The encoded enzyme specifically adds and removes nucleotides from the 3' end of small nuclear RNAs and select mRNAs and may function in controlling gene expression and cell proliferation.[provided by RefSeq, Apr 2009]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik A G 7: 118,833,748 N568S probably damaging Het
A2m C A 6: 121,654,612 L623M probably benign Het
Abhd2 T C 7: 79,348,356 I212T possibly damaging Het
Adam7 A C 14: 68,512,625 S449A possibly damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Aox3 T C 1: 58,180,651 Y1137H probably damaging Het
Atp11b T C 3: 35,834,325 Y715H probably damaging Het
Atrn A G 2: 130,995,051 Y1145C probably damaging Het
Btbd7 A G 12: 102,793,796 I631T probably benign Het
Cadps T C 14: 12,465,859 K1017R possibly damaging Het
Cfap45 A G 1: 172,545,112 E458G probably damaging Het
Cptp C T 4: 155,866,538 R157H probably damaging Het
Dcbld1 A C 10: 52,319,651 E318D possibly damaging Het
Ddr2 G T 1: 170,004,245 P197Q probably damaging Het
Dlg5 T C 14: 24,176,571 Y421C probably damaging Het
Dlgap2 A G 8: 14,843,624 K980E probably benign Het
Drc7 T C 8: 95,056,016 V3A unknown Het
Dst T C 1: 34,161,029 V96A probably damaging Het
Ect2l T C 10: 18,143,004 D548G possibly damaging Het
Efcab10 A T 12: 33,398,435 Y89F probably benign Het
Eif1ad CGAGGAGGAGGAGGAGGAGG CGAGGAGGAGGAGGAGG 19: 5,370,058 probably benign Het
Entpd6 A G 2: 150,758,812 T147A probably damaging Het
Fbxl5 T A 5: 43,765,490 E189D probably benign Het
Fer1l6 T A 15: 58,625,231 S1217T probably damaging Het
Frem2 A T 3: 53,653,495 V1197D possibly damaging Het
Fsip2 T A 2: 82,980,783 L2482* probably null Het
Fsip2 A T 2: 82,986,820 D4299V probably benign Het
Gipc3 T A 10: 81,338,215 I242F probably damaging Het
Hoxb1 T A 11: 96,366,112 Y96N probably damaging Het
Ibsp A G 5: 104,310,212 E205G probably damaging Het
Ibtk A G 9: 85,703,082 S1170P probably benign Het
Igfn1 A G 1: 135,966,063 probably null Het
Iqsec1 A G 6: 90,662,895 S954P probably benign Het
Kalrn A T 16: 34,392,093 D28E probably benign Het
Lrmda T C 14: 22,577,870 F52L probably damaging Het
Lrp2 T C 2: 69,523,287 D543G probably damaging Het
Lrrtm3 T C 10: 64,088,378 T337A probably benign Het
Marf1 C T 16: 14,128,601 D1219N possibly damaging Het
Mkln1 A G 6: 31,428,178 K118R probably benign Het
Nedd4l T C 18: 65,167,575 probably null Het
Neu2 A G 1: 87,597,301 E336G probably benign Het
Nfasc A G 1: 132,610,805 F448S probably damaging Het
Nlrx1 C A 9: 44,254,134 E822* probably null Het
Nr5a1 T C 2: 38,694,096 Y437C probably damaging Het
Olfr1224-ps1 A G 2: 89,156,581 V198A probably benign Het
Olfr1353 T A 10: 78,970,141 L164* probably null Het
Olfr885 T C 9: 38,061,685 Y122H probably damaging Het
Phtf1 C T 3: 103,969,122 Q13* probably null Het
Pnldc1 A G 17: 12,888,928 L525P possibly damaging Het
Ppl T A 16: 5,106,124 D162V possibly damaging Het
Prkdc T A 16: 15,714,215 S1448T possibly damaging Het
Ptgdr A G 14: 44,853,281 I340T probably benign Het
Recql T C 6: 142,365,589 I458M probably benign Het
Rrbp1 A T 2: 143,988,291 V652E probably benign Het
Rtp1 T A 16: 23,431,410 I175N probably damaging Het
Ryr1 A G 7: 29,054,944 M3523T probably damaging Het
S100a16 T C 3: 90,542,396 L62P probably damaging Het
Samd11 T C 4: 156,248,709 E364G probably damaging Het
Satb1 C A 17: 51,742,115 G603* probably null Het
Shroom3 T A 5: 92,962,365 probably null Het
Slc25a15 A G 8: 22,395,761 S3P probably benign Het
Socs2 A T 10: 95,413,038 L71* probably null Het
Sptbn1 T C 11: 30,104,469 E2208G probably damaging Het
St14 A G 9: 31,089,870 V855A possibly damaging Het
Susd1 T A 4: 59,412,191 T121S probably benign Het
Svs3b A T 2: 164,255,928 S158T probably benign Het
Synpo C T 18: 60,603,589 M428I probably benign Het
Syt10 C T 15: 89,790,776 D456N probably damaging Het
Taar4 A G 10: 23,961,341 D283G probably damaging Het
Tango6 T A 8: 106,688,794 D82E probably benign Het
Tcof1 T C 18: 60,838,855 T127A possibly damaging Het
Tle3 G A 9: 61,411,340 probably null Het
Tmem45a A G 16: 56,822,302 F169L probably benign Het
Trp53rkb T A 2: 166,795,823 V233E probably damaging Het
Ttc7b C T 12: 100,415,130 probably null Het
Tubgcp3 A T 8: 12,621,932 L770* probably null Het
Ubr1 G A 2: 120,930,968 T576I probably benign Het
Vmn1r125 T A 7: 21,272,605 Y143N probably damaging Het
Vmn2r120 T A 17: 57,524,839 I317F probably benign Het
Vmn2r95 T A 17: 18,424,313 N70K probably benign Het
Wdr59 A T 8: 111,486,950 L311* probably null Het
Wnt2 A G 6: 18,030,253 L12P unknown Het
Xrn1 T C 9: 95,999,497 I700T probably benign Het
Ypel1 A G 16: 17,082,579 H98R probably benign Het
Zfp219 T C 14: 52,008,234 T434A probably benign Het
Zik1 A C 7: 10,490,016 C385G probably damaging Het
Other mutations in Tut1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Tut1 APN 19 8959096 missense probably damaging 1.00
IGL01934:Tut1 APN 19 8953991 missense probably damaging 1.00
IGL01980:Tut1 APN 19 8954000 missense probably damaging 1.00
IGL02115:Tut1 APN 19 8965312 missense probably damaging 1.00
IGL02375:Tut1 APN 19 8964039 missense probably damaging 1.00
IGL02683:Tut1 APN 19 8965258 missense probably benign 0.31
IGL02899:Tut1 APN 19 8962387 missense probably damaging 1.00
IGL02953:Tut1 APN 19 8962692 missense probably damaging 1.00
PIT4280001:Tut1 UTSW 19 8959262 missense probably benign 0.00
R0014:Tut1 UTSW 19 8962447 missense possibly damaging 0.61
R0014:Tut1 UTSW 19 8962447 missense possibly damaging 0.61
R0033:Tut1 UTSW 19 8962759 missense probably benign 0.03
R0091:Tut1 UTSW 19 8965436 missense probably damaging 0.97
R0173:Tut1 UTSW 19 8965483 nonsense probably null
R0362:Tut1 UTSW 19 8955527 missense possibly damaging 0.94
R0371:Tut1 UTSW 19 8962773 missense probably damaging 0.98
R0386:Tut1 UTSW 19 8955555 missense probably benign 0.00
R1022:Tut1 UTSW 19 8959355 missense probably benign
R1024:Tut1 UTSW 19 8959355 missense probably benign
R1539:Tut1 UTSW 19 8965486 missense probably benign 0.02
R1958:Tut1 UTSW 19 8959313 missense probably damaging 1.00
R2508:Tut1 UTSW 19 8955567 missense probably damaging 0.98
R4757:Tut1 UTSW 19 8959308 missense possibly damaging 0.83
R5104:Tut1 UTSW 19 8959334 missense probably benign 0.03
R5185:Tut1 UTSW 19 8955450 missense probably benign 0.07
R6999:Tut1 UTSW 19 8966018 missense probably damaging 1.00
R7084:Tut1 UTSW 19 8965414 missense probably benign
R7091:Tut1 UTSW 19 8965811 missense probably benign
R7313:Tut1 UTSW 19 8964049 missense probably benign 0.00
R7361:Tut1 UTSW 19 8965334 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCCATCATCAGTGAGCTGG -3'
(R):5'- GCCAGAAGCTACATTGAGGC -3'

Sequencing Primer
(F):5'- TAGAGGAGGTCCCACCACAG -3'
(R):5'- AAAAAGGCGTTACCAGGAGG -3'
Posted On2014-07-14