Incidental Mutation 'R0125:Slc35b1'
Institutional Source Beutler Lab
Gene Symbol Slc35b1
Ensembl Gene ENSMUSG00000020873
Gene Namesolute carrier family 35, member B1
MMRRC Submission 038410-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.946) question?
Stock #R0125 (G1)
Quality Score225
Status Validated (trace)
Chromosomal Location95384692-95391776 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 95386527 bp
Amino Acid Change Threonine to Serine at position 74 (T74S)
Ref Sequence ENSEMBL: ENSMUSP00000125597 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021243] [ENSMUST00000037502] [ENSMUST00000131193] [ENSMUST00000146556] [ENSMUST00000232252]
Predicted Effect probably benign
Transcript: ENSMUST00000021243
AA Change: T120S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000021243
Gene: ENSMUSG00000020873
AA Change: T120S

Pfam:TPT 12 309 1.3e-14 PFAM
Pfam:UAA 13 313 2.1e-58 PFAM
Pfam:EamA 170 309 1.9e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000037502
SMART Domains Protein: ENSMUSP00000049162
Gene: ENSMUSG00000038893

low complexity region 3 27 N/A INTRINSIC
Pfam:FAM117 86 397 3.6e-116 PFAM
Predicted Effect silent
Transcript: ENSMUST00000131193
SMART Domains Protein: ENSMUSP00000125307
Gene: ENSMUSG00000020873

Pfam:UAA 14 91 5.6e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141284
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143090
Predicted Effect probably benign
Transcript: ENSMUST00000146556
AA Change: T74S

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000125597
Gene: ENSMUSG00000020873
AA Change: T74S

low complexity region 14 23 N/A INTRINSIC
Pfam:EmrE 38 149 3.9e-9 PFAM
Pfam:UAA 46 153 4.5e-30 PFAM
Pfam:EamA 63 146 1.4e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189860
Predicted Effect probably benign
Transcript: ENSMUST00000232252
AA Change: T84S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.7%
  • 20x: 87.1%
Validation Efficiency 98% (96/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nucleotide sugar transporter which is a member of solute carrier family 35. The transporters in this family are highly conserved hydrophobic proteins with multiple transmembrane domains. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930012K11Rik T C 14: 70,156,647 probably benign Het
Adam23 T C 1: 63,534,356 L261P probably benign Het
Adgra3 G A 5: 50,001,852 probably benign Het
Agtr1b A G 3: 20,315,540 F301L probably benign Het
Ahnak2 G A 12: 112,785,156 T357I probably benign Het
Aldh1a7 T C 19: 20,727,066 probably benign Het
Apoh A T 11: 108,412,073 N288I probably damaging Het
Arfgap3 A G 15: 83,343,139 V24A probably benign Het
Atp6v0a1 A G 11: 101,038,851 probably null Het
Axl A T 7: 25,786,943 M112K probably benign Het
Bnc2 A C 4: 84,292,932 I425S probably damaging Het
Cdc42bpa C T 1: 179,961,198 T30M probably damaging Het
Cebpz C A 17: 78,919,888 R1051M possibly damaging Het
Ces1d A C 8: 93,175,182 probably benign Het
Chd1l T C 3: 97,587,149 N405S probably benign Het
Chodl G T 16: 78,941,423 G93V probably damaging Het
Cpeb2 C T 5: 43,238,400 probably benign Het
Crebbp A G 16: 4,117,241 probably benign Het
Crybb3 T C 5: 113,079,809 T49A possibly damaging Het
Ctps A G 4: 120,561,525 probably benign Het
Cyp26b1 A G 6: 84,574,515 Y240H probably damaging Het
Cyp2d11 A C 15: 82,389,221 V483G probably benign Het
Dnah14 A T 1: 181,752,063 N3054Y probably damaging Het
Dspp A C 5: 104,178,039 D756A unknown Het
Dst T C 1: 34,270,903 S1553P probably damaging Het
Elp4 A G 2: 105,792,214 probably null Het
Eml6 G T 11: 29,882,088 T194K probably benign Het
Evi5 A G 5: 107,795,772 I569T probably benign Het
Fam129b T A 2: 32,923,821 V682D probably benign Het
Fancm C T 12: 65,121,956 P1698S possibly damaging Het
Fhdc1 T C 3: 84,445,545 D791G probably benign Het
Frem1 A G 4: 83,011,951 Y253H probably damaging Het
Gpn3 A G 5: 122,381,418 Y196C probably benign Het
Hcls1 A G 16: 36,962,163 D398G probably benign Het
Hydin T C 8: 110,462,531 V1189A probably benign Het
Itgb3 G A 11: 104,643,963 D549N probably damaging Het
Itpr2 A G 6: 146,240,453 F1697S probably benign Het
Klk1b11 A G 7: 43,999,051 T161A probably benign Het
Kntc1 G A 5: 123,765,057 probably benign Het
Map3k19 A T 1: 127,823,100 F838Y probably benign Het
Map6 T A 7: 99,335,980 probably null Het
Mcrs1 A G 15: 99,244,727 probably benign Het
Mdn1 A T 4: 32,729,956 Y2766F probably damaging Het
Med23 C T 10: 24,900,788 H739Y probably damaging Het
Mmp17 T A 5: 129,594,582 D65E possibly damaging Het
Mmp9 T A 2: 164,951,257 L442Q probably damaging Het
Myo19 T C 11: 84,888,175 probably benign Het
Nedd1 A C 10: 92,691,929 S468A possibly damaging Het
Nlrp4d A C 7: 10,382,389 V152G probably damaging Het
Nxf1 T A 19: 8,762,806 D112E probably benign Het
Oas1h A T 5: 120,862,563 K79* probably null Het
Olfr494 A G 7: 108,368,369 Y293C probably damaging Het
Olfr888 A G 9: 38,109,519 T278A probably benign Het
Olfr904 T A 9: 38,464,461 L140* probably null Het
Omg T A 11: 79,502,853 I60F possibly damaging Het
Pck1 G A 2: 173,156,081 W314* probably null Het
Pla2g15 T C 8: 106,163,124 Y343H probably benign Het
Plcb3 T C 19: 6,958,908 E749G probably damaging Het
Plgrkt A G 19: 29,351,042 probably null Het
Pprc1 A G 19: 46,069,512 probably benign Het
Prkdc A T 16: 15,699,007 I1082F probably damaging Het
Rapgef6 T A 11: 54,625,875 Y172* probably null Het
Ros1 G T 10: 52,125,789 A1079D probably benign Het
Sap30 T C 8: 57,485,511 E147G probably null Het
Sell T C 1: 164,072,105 probably benign Het
Senp1 A T 15: 98,048,231 D544E probably damaging Het
Shpk G A 11: 73,214,222 probably benign Het
Slc6a3 T A 13: 73,569,979 probably benign Het
Slf1 T C 13: 77,043,745 N990S probably benign Het
Smgc A G 15: 91,854,543 probably benign Het
Snx19 T A 9: 30,440,219 V861D probably damaging Het
Sprr2e C T 3: 92,352,978 P39S unknown Het
Sstr2 T A 11: 113,624,477 M74K probably damaging Het
St5 T C 7: 109,556,338 K402E probably benign Het
Svep1 T C 4: 58,099,937 probably benign Het
Tas2r143 A G 6: 42,400,955 I240V probably benign Het
Tbrg1 T C 9: 37,652,641 I233V probably benign Het
Tecpr1 G T 5: 144,197,899 D1055E probably damaging Het
Thap2 A T 10: 115,376,372 probably null Het
Tinagl1 A G 4: 130,166,308 Y388H probably damaging Het
Ttn T A 2: 76,755,552 Y21945F probably damaging Het
Ugt2b1 A T 5: 86,926,102 W133R probably benign Het
Usp24 C T 4: 106,397,299 P1491L possibly damaging Het
Utp15 A G 13: 98,250,882 S395P possibly damaging Het
Vav1 T A 17: 57,299,847 L254Q probably damaging Het
Vmn2r104 T C 17: 20,029,807 Y734C probably damaging Het
Vps8 T A 16: 21,470,154 V421E probably benign Het
Wisp1 T C 15: 66,917,345 S227P possibly damaging Het
Xkr7 G T 2: 153,032,426 A138S probably benign Het
Other mutations in Slc35b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01616:Slc35b1 APN 11 95389084 missense probably benign 0.01
IGL03151:Slc35b1 APN 11 95390386 critical splice donor site probably null
R0026:Slc35b1 UTSW 11 95390642 missense probably benign
R0026:Slc35b1 UTSW 11 95390642 missense probably benign
R1331:Slc35b1 UTSW 11 95385863 missense probably damaging 1.00
R2061:Slc35b1 UTSW 11 95385892 missense possibly damaging 0.72
R2192:Slc35b1 UTSW 11 95385814 missense probably damaging 1.00
R5283:Slc35b1 UTSW 11 95384988 start gained probably benign
R5484:Slc35b1 UTSW 11 95387805 missense probably damaging 1.00
R7620:Slc35b1 UTSW 11 95387865 missense probably damaging 1.00
R8678:Slc35b1 UTSW 11 95387820 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- gcctctgattctgaccctcc -3'
Posted On2013-04-11