Incidental Mutation 'R1922:Doc2a'
ID213145
Institutional Source Beutler Lab
Gene Symbol Doc2a
Ensembl Gene ENSMUSG00000052301
Gene Namedouble C2, alpha
Synonyms
MMRRC Submission 039940-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R1922 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location126847416-126852705 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 126851431 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 293 (D293A)
Ref Sequence ENSEMBL: ENSMUSP00000070119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050833] [ENSMUST00000064110] [ENSMUST00000106342] [ENSMUST00000106343] [ENSMUST00000137873] [ENSMUST00000139174] [ENSMUST00000141805] [ENSMUST00000147257] [ENSMUST00000152051] [ENSMUST00000206349] [ENSMUST00000206968] [ENSMUST00000205938]
Predicted Effect probably benign
Transcript: ENSMUST00000050833
SMART Domains Protein: ENSMUSP00000049851
Gene: ENSMUSG00000030689

DomainStartEndE-ValueType
low complexity region 25 42 N/A INTRINSIC
low complexity region 59 81 N/A INTRINSIC
low complexity region 86 108 N/A INTRINSIC
low complexity region 116 132 N/A INTRINSIC
low complexity region 163 171 N/A INTRINSIC
low complexity region 184 199 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000064110
AA Change: D293A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000070119
Gene: ENSMUSG00000052301
AA Change: D293A

DomainStartEndE-ValueType
Blast:C2 8 37 2e-10 BLAST
low complexity region 40 56 N/A INTRINSIC
low complexity region 57 78 N/A INTRINSIC
C2 110 215 1.68e-22 SMART
low complexity region 223 234 N/A INTRINSIC
C2 272 386 2.44e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106342
SMART Domains Protein: ENSMUSP00000101949
Gene: ENSMUSG00000030689

DomainStartEndE-ValueType
low complexity region 44 66 N/A INTRINSIC
low complexity region 74 90 N/A INTRINSIC
low complexity region 121 129 N/A INTRINSIC
low complexity region 142 157 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106343
SMART Domains Protein: ENSMUSP00000101950
Gene: ENSMUSG00000030689

DomainStartEndE-ValueType
coiled coil region 10 55 N/A INTRINSIC
low complexity region 64 81 N/A INTRINSIC
low complexity region 98 120 N/A INTRINSIC
low complexity region 125 147 N/A INTRINSIC
low complexity region 155 171 N/A INTRINSIC
low complexity region 202 210 N/A INTRINSIC
low complexity region 223 238 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125624
Predicted Effect probably benign
Transcript: ENSMUST00000137873
SMART Domains Protein: ENSMUSP00000119779
Gene: ENSMUSG00000052301

DomainStartEndE-ValueType
Blast:C2 8 37 1e-11 BLAST
low complexity region 40 56 N/A INTRINSIC
low complexity region 57 78 N/A INTRINSIC
C2 110 175 1.44e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139174
SMART Domains Protein: ENSMUSP00000117376
Gene: ENSMUSG00000052301

DomainStartEndE-ValueType
Blast:C2 8 37 2e-12 BLAST
low complexity region 40 56 N/A INTRINSIC
low complexity region 57 78 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141805
SMART Domains Protein: ENSMUSP00000118143
Gene: ENSMUSG00000052301

DomainStartEndE-ValueType
Blast:C2 8 37 5e-12 BLAST
low complexity region 40 56 N/A INTRINSIC
low complexity region 57 78 N/A INTRINSIC
SCOP:d1rsy__ 81 134 1e-10 SMART
PDB:4MJJ|A 86 134 6e-26 PDB
Blast:C2 110 134 5e-10 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000147257
SMART Domains Protein: ENSMUSP00000123143
Gene: ENSMUSG00000052301

DomainStartEndE-ValueType
Blast:C2 8 37 2e-12 BLAST
low complexity region 40 56 N/A INTRINSIC
low complexity region 57 78 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152051
SMART Domains Protein: ENSMUSP00000123483
Gene: ENSMUSG00000052301

DomainStartEndE-ValueType
Blast:C2 8 37 6e-11 BLAST
low complexity region 40 56 N/A INTRINSIC
low complexity region 57 78 N/A INTRINSIC
C2 110 215 1.68e-22 SMART
low complexity region 223 234 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152406
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153764
Predicted Effect probably benign
Transcript: ENSMUST00000206349
Predicted Effect probably benign
Transcript: ENSMUST00000206968
Predicted Effect probably benign
Transcript: ENSMUST00000205619
Predicted Effect probably benign
Transcript: ENSMUST00000205958
Predicted Effect probably benign
Transcript: ENSMUST00000205938
Predicted Effect probably benign
Transcript: ENSMUST00000206090
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154881
Predicted Effect probably benign
Transcript: ENSMUST00000176771
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.1%
  • 10x: 95.8%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] There are at least two protein isoforms of the Double C2 protein, namely alpha (DOC2A) and beta (DOC2B), which contain two C2-like domains. DOC2A and DOC2B are encoded by different genes; these genes are at times confused with the unrelated DAB2 gene which was initially named DOC-2. DOC2A is mainly expressed in brain and is suggested to be involved in Ca(2+)-dependent neurotransmitter release. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Homozygous inactivation of this locus affects excitatory synaptic transmission, LTP, and learning/memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A C 6: 48,931,286 I407L probably benign Het
Abca12 G T 1: 71,319,924 N574K probably benign Het
Adcy9 A T 16: 4,311,657 L455H probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Amy1 T A 3: 113,564,895 I163F probably damaging Het
Armc5 A G 7: 128,240,505 S332G probably benign Het
Brd4 T C 17: 32,198,086 probably benign Het
Cadps T C 14: 12,465,859 K1017R possibly damaging Het
Cfap45 A G 1: 172,545,112 E458G probably damaging Het
Chrna1 A G 2: 73,568,232 S288P probably damaging Het
Cpe T A 8: 64,617,689 D174V probably benign Het
Dclre1c T C 2: 3,440,782 F235L possibly damaging Het
Ddx20 A T 3: 105,678,584 V815D probably damaging Het
Dhx9 T C 1: 153,460,274 probably null Het
Dmxl2 A C 9: 54,401,523 H1981Q probably benign Het
Eif2a C T 3: 58,548,530 R317C probably damaging Het
Fancc A G 13: 63,330,567 V318A possibly damaging Het
Fes A T 7: 80,383,986 Y172* probably null Het
Gipc3 T A 10: 81,338,215 I242F probably damaging Het
Glul G A 1: 153,907,324 M214I probably benign Het
Gm14496 A G 2: 182,001,004 I823V probably benign Het
Gm6665 T C 18: 31,820,265 N50S probably benign Het
Gm6729 T C 10: 86,540,918 noncoding transcript Het
Gpr21 T A 2: 37,518,338 C299S probably damaging Het
Hapln2 T A 3: 88,023,377 N196Y probably benign Het
Hsd17b12 A G 2: 94,045,392 V196A probably benign Het
Kalrn A T 16: 34,392,093 D28E probably benign Het
Kansl1 A T 11: 104,343,640 L680Q probably damaging Het
Kcna3 T C 3: 107,037,935 S505P possibly damaging Het
Klra1 A C 6: 130,372,865 N203K probably benign Het
L3mbtl2 T A 15: 81,675,621 I236N probably damaging Het
Mcm3ap C A 10: 76,507,361 P1696T probably damaging Het
Mecom T C 3: 29,957,442 D647G probably damaging Het
Mn1 A G 5: 111,418,746 D194G probably damaging Het
Muc5ac A G 7: 141,793,689 N407S probably benign Het
Mx2 C T 16: 97,560,351 R584C probably benign Het
Myo1c A G 11: 75,668,229 R597G probably benign Het
Nav3 T C 10: 109,705,606 D1932G probably benign Het
Nwd2 T A 5: 63,794,242 D205E probably benign Het
Olfr1353 T A 10: 78,970,141 L164* probably null Het
Olfr885 T C 9: 38,061,685 Y122H probably damaging Het
Osmr T C 15: 6,844,367 E183G possibly damaging Het
Peak1 A T 9: 56,206,687 W627R probably damaging Het
Pkd1 C A 17: 24,595,157 P4167Q probably damaging Het
Plekhg4 T A 8: 105,378,385 L560Q probably damaging Het
Prg4 C T 1: 150,449,999 W1217* probably null Het
Prkdc A G 16: 15,714,266 I1465V probably benign Het
Pus1 A G 5: 110,777,639 F105S probably damaging Het
Ranbp3l T C 15: 9,057,125 S154P probably damaging Het
Rhbdl1 C T 17: 25,835,539 G211S probably damaging Het
Rnf219 T C 14: 104,479,186 K584E probably benign Het
Rrp36 C T 17: 46,672,745 R47Q possibly damaging Het
Rtp1 T A 16: 23,431,410 I175N probably damaging Het
Sash1 T A 10: 8,727,908 N1127Y possibly damaging Het
Setbp1 C T 18: 78,858,362 E697K possibly damaging Het
Slc27a3 A T 3: 90,386,317 V587E probably benign Het
Slc38a2 A G 15: 96,691,162 F454L possibly damaging Het
Sprn A T 7: 140,153,545 probably benign Het
St14 A G 9: 31,089,870 V855A possibly damaging Het
Syt10 C T 15: 89,790,776 D456N probably damaging Het
Tbc1d1 A G 5: 64,311,221 E732G probably damaging Het
Tnfaip3 A G 10: 19,003,607 F671S possibly damaging Het
Tor1aip2 C A 1: 156,064,794 P282Q probably damaging Het
Ttc7b C T 12: 100,415,130 probably null Het
Ttll2 A T 17: 7,352,390 F46Y probably damaging Het
Ttn A G 2: 76,734,150 S28548P probably damaging Het
Tubb5 T C 17: 35,835,298 Y340C probably benign Het
Usp32 A T 11: 85,007,004 C1170* probably null Het
Usp54 G T 14: 20,560,904 H1281Q probably benign Het
Vgll4 C T 6: 114,921,335 G22S probably benign Het
Vmn2r120 T A 17: 57,524,839 I317F probably benign Het
Zdhhc5 A T 2: 84,693,427 F225Y probably damaging Het
Zfp652 A G 11: 95,764,025 E418G possibly damaging Het
Other mutations in Doc2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01287:Doc2a APN 7 126851001 missense probably damaging 1.00
R0423:Doc2a UTSW 7 126848658 missense probably damaging 1.00
R0538:Doc2a UTSW 7 126848811 missense probably benign 0.15
R1992:Doc2a UTSW 7 126851807 critical splice donor site probably null
R2402:Doc2a UTSW 7 126848747 nonsense probably null
R4344:Doc2a UTSW 7 126851149 missense probably damaging 1.00
R4644:Doc2a UTSW 7 126851446 missense probably benign 0.02
R4741:Doc2a UTSW 7 126851445 missense possibly damaging 0.48
R4932:Doc2a UTSW 7 126848580 unclassified probably benign
R5926:Doc2a UTSW 7 126849525 missense probably damaging 1.00
R6646:Doc2a UTSW 7 126851619 critical splice donor site probably null
R8058:Doc2a UTSW 7 126850992 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- AGAGCCTGTAGACTCACCTCTG -3'
(R):5'- TGTGAGGCCTAACCACATCG -3'

Sequencing Primer
(F):5'- GTAGACTCACCTCTGCCCCC -3'
(R):5'- GGCCTAACCACATCGCTGTC -3'
Posted On2014-07-14