Incidental Mutation 'R1922:Armc5'
ID213146
Institutional Source Beutler Lab
Gene Symbol Armc5
Ensembl Gene ENSMUSG00000042178
Gene Namearmadillo repeat containing 5
Synonyms
MMRRC Submission 039940-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.867) question?
Stock #R1922 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location128237342-128245100 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 128240505 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 332 (S332G)
Ref Sequence ENSEMBL: ENSMUSP00000040568 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044660] [ENSMUST00000078816]
Predicted Effect probably benign
Transcript: ENSMUST00000044660
AA Change: S332G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000040568
Gene: ENSMUSG00000042178
AA Change: S332G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 62 104 N/A INTRINSIC
ARM 137 179 2.89e-1 SMART
ARM 180 221 3.32e-1 SMART
ARM 222 263 2.93e-2 SMART
Blast:ARM 265 306 1e-8 BLAST
low complexity region 313 338 N/A INTRINSIC
ARM 353 399 4.88e0 SMART
low complexity region 418 431 N/A INTRINSIC
low complexity region 670 690 N/A INTRINSIC
Pfam:BTB 742 854 9.6e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000078816
SMART Domains Protein: ENSMUSP00000077867
Gene: ENSMUSG00000062944

DomainStartEndE-ValueType
ZnF_C2H2 88 110 1.89e-1 SMART
ZnF_C2H2 116 138 7.49e-5 SMART
ZnF_C2H2 144 166 1.12e-3 SMART
ZnF_C2H2 172 194 2.4e-3 SMART
ZnF_C2H2 200 222 1.95e-3 SMART
ZnF_C2H2 228 250 3.89e-3 SMART
ZnF_C2H2 256 278 1.1e-2 SMART
ZnF_C2H2 284 306 1.33e-1 SMART
ZnF_C2H2 312 334 2.53e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206509
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.1%
  • 10x: 95.8%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ARM (armadillo/beta-catenin-like repeat) superfamily. The ARM repeat is a tandemly repeated sequence motif with approximately 40 amino acid long. This repeat is implicated in mediating protein-protein interactions. The encoded protein contains seven ARM repeats. Mutations in this gene are associated with primary bilateral macronodular adrenal hyperplasia, which is also known as ACTH-independent macronodular adrenal hyperplasia 2. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality with defects in mesoderm formation and gastrulation. The few survbiving mice are smaller than normal. Mice heterozygous for the same allele exhibit abnormal adrenocortical morphology and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A C 6: 48,931,286 I407L probably benign Het
Abca12 G T 1: 71,319,924 N574K probably benign Het
Adcy9 A T 16: 4,311,657 L455H probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Amy1 T A 3: 113,564,895 I163F probably damaging Het
Brd4 T C 17: 32,198,086 probably benign Het
Cadps T C 14: 12,465,859 K1017R possibly damaging Het
Cfap45 A G 1: 172,545,112 E458G probably damaging Het
Chrna1 A G 2: 73,568,232 S288P probably damaging Het
Cpe T A 8: 64,617,689 D174V probably benign Het
Dclre1c T C 2: 3,440,782 F235L possibly damaging Het
Ddx20 A T 3: 105,678,584 V815D probably damaging Het
Dhx9 T C 1: 153,460,274 probably null Het
Dmxl2 A C 9: 54,401,523 H1981Q probably benign Het
Doc2a A C 7: 126,851,431 D293A probably damaging Het
Eif2a C T 3: 58,548,530 R317C probably damaging Het
Fancc A G 13: 63,330,567 V318A possibly damaging Het
Fes A T 7: 80,383,986 Y172* probably null Het
Gipc3 T A 10: 81,338,215 I242F probably damaging Het
Glul G A 1: 153,907,324 M214I probably benign Het
Gm14496 A G 2: 182,001,004 I823V probably benign Het
Gm6665 T C 18: 31,820,265 N50S probably benign Het
Gm6729 T C 10: 86,540,918 noncoding transcript Het
Gpr21 T A 2: 37,518,338 C299S probably damaging Het
Hapln2 T A 3: 88,023,377 N196Y probably benign Het
Hsd17b12 A G 2: 94,045,392 V196A probably benign Het
Kalrn A T 16: 34,392,093 D28E probably benign Het
Kansl1 A T 11: 104,343,640 L680Q probably damaging Het
Kcna3 T C 3: 107,037,935 S505P possibly damaging Het
Klra1 A C 6: 130,372,865 N203K probably benign Het
L3mbtl2 T A 15: 81,675,621 I236N probably damaging Het
Mcm3ap C A 10: 76,507,361 P1696T probably damaging Het
Mecom T C 3: 29,957,442 D647G probably damaging Het
Mn1 A G 5: 111,418,746 D194G probably damaging Het
Muc5ac A G 7: 141,793,689 N407S probably benign Het
Mx2 C T 16: 97,560,351 R584C probably benign Het
Myo1c A G 11: 75,668,229 R597G probably benign Het
Nav3 T C 10: 109,705,606 D1932G probably benign Het
Nwd2 T A 5: 63,794,242 D205E probably benign Het
Olfr1353 T A 10: 78,970,141 L164* probably null Het
Olfr885 T C 9: 38,061,685 Y122H probably damaging Het
Osmr T C 15: 6,844,367 E183G possibly damaging Het
Peak1 A T 9: 56,206,687 W627R probably damaging Het
Pkd1 C A 17: 24,595,157 P4167Q probably damaging Het
Plekhg4 T A 8: 105,378,385 L560Q probably damaging Het
Prg4 C T 1: 150,449,999 W1217* probably null Het
Prkdc A G 16: 15,714,266 I1465V probably benign Het
Pus1 A G 5: 110,777,639 F105S probably damaging Het
Ranbp3l T C 15: 9,057,125 S154P probably damaging Het
Rhbdl1 C T 17: 25,835,539 G211S probably damaging Het
Rnf219 T C 14: 104,479,186 K584E probably benign Het
Rrp36 C T 17: 46,672,745 R47Q possibly damaging Het
Rtp1 T A 16: 23,431,410 I175N probably damaging Het
Sash1 T A 10: 8,727,908 N1127Y possibly damaging Het
Setbp1 C T 18: 78,858,362 E697K possibly damaging Het
Slc27a3 A T 3: 90,386,317 V587E probably benign Het
Slc38a2 A G 15: 96,691,162 F454L possibly damaging Het
Sprn A T 7: 140,153,545 probably benign Het
St14 A G 9: 31,089,870 V855A possibly damaging Het
Syt10 C T 15: 89,790,776 D456N probably damaging Het
Tbc1d1 A G 5: 64,311,221 E732G probably damaging Het
Tnfaip3 A G 10: 19,003,607 F671S possibly damaging Het
Tor1aip2 C A 1: 156,064,794 P282Q probably damaging Het
Ttc7b C T 12: 100,415,130 probably null Het
Ttll2 A T 17: 7,352,390 F46Y probably damaging Het
Ttn A G 2: 76,734,150 S28548P probably damaging Het
Tubb5 T C 17: 35,835,298 Y340C probably benign Het
Usp32 A T 11: 85,007,004 C1170* probably null Het
Usp54 G T 14: 20,560,904 H1281Q probably benign Het
Vgll4 C T 6: 114,921,335 G22S probably benign Het
Vmn2r120 T A 17: 57,524,839 I317F probably benign Het
Zdhhc5 A T 2: 84,693,427 F225Y probably damaging Het
Zfp652 A G 11: 95,764,025 E418G possibly damaging Het
Other mutations in Armc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02111:Armc5 APN 7 128244083 missense probably benign 0.00
R0538:Armc5 UTSW 7 128244291 missense probably damaging 1.00
R0718:Armc5 UTSW 7 128240070 unclassified probably benign
R0920:Armc5 UTSW 7 128240319 missense probably damaging 1.00
R2943:Armc5 UTSW 7 128240580 missense probably damaging 1.00
R4663:Armc5 UTSW 7 128238545 missense probably benign 0.14
R4679:Armc5 UTSW 7 128240104 missense possibly damaging 0.95
R4910:Armc5 UTSW 7 128240728 missense possibly damaging 0.67
R5466:Armc5 UTSW 7 128240164 missense probably damaging 0.99
R5954:Armc5 UTSW 7 128242272 missense probably benign 0.18
R6912:Armc5 UTSW 7 128240425 missense probably damaging 1.00
R6940:Armc5 UTSW 7 128240298 nonsense probably null
R8410:Armc5 UTSW 7 128240151 missense probably damaging 1.00
Z1177:Armc5 UTSW 7 128240625 missense probably damaging 1.00
Z1177:Armc5 UTSW 7 128240830 missense probably damaging 0.98
Z1177:Armc5 UTSW 7 128244663 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCTTGGAACTCAGCCGAG -3'
(R):5'- GGCCCCAGTATCATAAAGGAAG -3'

Sequencing Primer
(F):5'- CTGAGCAGCTAAGTCTGGG -3'
(R):5'- TATCATAAAGGAAGCCTACAAGAGC -3'
Posted On2014-07-14