Incidental Mutation 'R1922:Dmxl2'
ID213155
Institutional Source Beutler Lab
Gene Symbol Dmxl2
Ensembl Gene ENSMUSG00000041268
Gene NameDmx-like 2
SynonymsE130119P06Rik, 6430411K14Rik
MMRRC Submission 039940-MU
Accession Numbers

NCBI RefSeq: NM_172771.2; MGI:2444630

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1922 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location54365158-54501626 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 54401523 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 1981 (H1981Q)
Ref Sequence ENSEMBL: ENSMUSP00000113705 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118163] [ENSMUST00000118600]
Predicted Effect probably benign
Transcript: ENSMUST00000118163
AA Change: H1981Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113705
Gene: ENSMUSG00000041268
AA Change: H1981Q

DomainStartEndE-ValueType
WD40 43 84 4.58e1 SMART
WD40 100 136 2.28e2 SMART
WD40 159 198 2.57e-2 SMART
WD40 221 269 1.03e-1 SMART
low complexity region 420 440 N/A INTRINSIC
WD40 741 793 1.42e2 SMART
low complexity region 861 875 N/A INTRINSIC
low complexity region 945 961 N/A INTRINSIC
WD40 985 1029 1.15e1 SMART
WD40 1236 1273 2.84e2 SMART
Pfam:Rav1p_C 1430 1903 1.5e-71 PFAM
low complexity region 1978 1993 N/A INTRINSIC
coiled coil region 2118 2146 N/A INTRINSIC
low complexity region 2189 2204 N/A INTRINSIC
low complexity region 2251 2266 N/A INTRINSIC
low complexity region 2472 2490 N/A INTRINSIC
low complexity region 2635 2649 N/A INTRINSIC
low complexity region 2744 2766 N/A INTRINSIC
WD40 2774 2809 5.73e0 SMART
WD40 2813 2852 8.88e0 SMART
WD40 2859 2901 2.67e-1 SMART
WD40 2907 2946 2.57e-2 SMART
WD40 2949 2988 3.61e-6 SMART
WD40 3001 3039 8.25e0 SMART
Predicted Effect unknown
Transcript: ENSMUST00000118600
AA Change: H1981Q
SMART Domains Protein: ENSMUSP00000113693
Gene: ENSMUSG00000041268
AA Change: H1981Q

DomainStartEndE-ValueType
WD40 43 84 4.58e1 SMART
WD40 100 136 2.28e2 SMART
WD40 159 198 2.57e-2 SMART
WD40 221 269 1.03e-1 SMART
low complexity region 420 440 N/A INTRINSIC
WD40 741 793 1.42e2 SMART
low complexity region 861 875 N/A INTRINSIC
low complexity region 945 961 N/A INTRINSIC
WD40 985 1029 1.15e1 SMART
WD40 1236 1273 2.84e2 SMART
low complexity region 1426 1436 N/A INTRINSIC
Pfam:Rav1p_C 1447 1903 4.2e-68 PFAM
low complexity region 1978 1993 N/A INTRINSIC
coiled coil region 2118 2146 N/A INTRINSIC
low complexity region 2189 2204 N/A INTRINSIC
low complexity region 2251 2266 N/A INTRINSIC
low complexity region 2471 2489 N/A INTRINSIC
low complexity region 2722 2744 N/A INTRINSIC
WD40 2752 2787 5.73e0 SMART
WD40 2791 2830 8.88e0 SMART
WD40 2837 2879 2.67e-1 SMART
WD40 2885 2924 2.57e-2 SMART
WD40 2927 2966 3.61e-6 SMART
WD40 2979 3017 8.25e0 SMART
Predicted Effect unknown
Transcript: ENSMUST00000123709
AA Change: H1182Q
SMART Domains Protein: ENSMUSP00000119959
Gene: ENSMUSG00000041268
AA Change: H1182Q

DomainStartEndE-ValueType
low complexity region 63 77 N/A INTRINSIC
low complexity region 147 163 N/A INTRINSIC
WD40 187 231 1.15e1 SMART
WD40 438 475 2.84e2 SMART
Pfam:Rav1p_C 632 1105 9.1e-72 PFAM
low complexity region 1180 1195 N/A INTRINSIC
coiled coil region 1319 1347 N/A INTRINSIC
low complexity region 1391 1406 N/A INTRINSIC
low complexity region 1453 1468 N/A INTRINSIC
low complexity region 1674 1692 N/A INTRINSIC
low complexity region 1925 1947 N/A INTRINSIC
WD40 1955 1990 5.73e0 SMART
WD40 1994 2033 8.88e0 SMART
WD40 2040 2082 2.67e-1 SMART
WD40 2088 2127 2.57e-2 SMART
WD40 2130 2169 3.61e-6 SMART
WD40 2182 2220 8.25e0 SMART
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.1%
  • 10x: 95.8%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with 12 WD domains. Proteins with WD domains are involved in many functions including participation in signal transduction pathways. Participation of the encoded protein in regulation of the Notch signaling pathway has been demonstrated in vitro using several human cell lines (PMID:20810660). A gene encoding a similar protein is located on chromosome 5. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete prenatal lethality. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(2) Gene trapped(2)

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A C 6: 48,931,286 I407L probably benign Het
Abca12 G T 1: 71,319,924 N574K probably benign Het
Adcy9 A T 16: 4,311,657 L455H probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Amy1 T A 3: 113,564,895 I163F probably damaging Het
Armc5 A G 7: 128,240,505 S332G probably benign Het
Brd4 T C 17: 32,198,086 probably benign Het
Cadps T C 14: 12,465,859 K1017R possibly damaging Het
Cfap45 A G 1: 172,545,112 E458G probably damaging Het
Chrna1 A G 2: 73,568,232 S288P probably damaging Het
Cpe T A 8: 64,617,689 D174V probably benign Het
Dclre1c T C 2: 3,440,782 F235L possibly damaging Het
Ddx20 A T 3: 105,678,584 V815D probably damaging Het
Dhx9 T C 1: 153,460,274 probably null Het
Doc2a A C 7: 126,851,431 D293A probably damaging Het
Eif2a C T 3: 58,548,530 R317C probably damaging Het
Fancc A G 13: 63,330,567 V318A possibly damaging Het
Fes A T 7: 80,383,986 Y172* probably null Het
Gipc3 T A 10: 81,338,215 I242F probably damaging Het
Glul G A 1: 153,907,324 M214I probably benign Het
Gm14496 A G 2: 182,001,004 I823V probably benign Het
Gm6665 T C 18: 31,820,265 N50S probably benign Het
Gm6729 T C 10: 86,540,918 noncoding transcript Het
Gpr21 T A 2: 37,518,338 C299S probably damaging Het
Hapln2 T A 3: 88,023,377 N196Y probably benign Het
Hsd17b12 A G 2: 94,045,392 V196A probably benign Het
Kalrn A T 16: 34,392,093 D28E probably benign Het
Kansl1 A T 11: 104,343,640 L680Q probably damaging Het
Kcna3 T C 3: 107,037,935 S505P possibly damaging Het
Klra1 A C 6: 130,372,865 N203K probably benign Het
L3mbtl2 T A 15: 81,675,621 I236N probably damaging Het
Mcm3ap C A 10: 76,507,361 P1696T probably damaging Het
Mecom T C 3: 29,957,442 D647G probably damaging Het
Mn1 A G 5: 111,418,746 D194G probably damaging Het
Muc5ac A G 7: 141,793,689 N407S probably benign Het
Mx2 C T 16: 97,560,351 R584C probably benign Het
Myo1c A G 11: 75,668,229 R597G probably benign Het
Nav3 T C 10: 109,705,606 D1932G probably benign Het
Nwd2 T A 5: 63,794,242 D205E probably benign Het
Olfr1353 T A 10: 78,970,141 L164* probably null Het
Olfr885 T C 9: 38,061,685 Y122H probably damaging Het
Osmr T C 15: 6,844,367 E183G possibly damaging Het
Peak1 A T 9: 56,206,687 W627R probably damaging Het
Pkd1 C A 17: 24,595,157 P4167Q probably damaging Het
Plekhg4 T A 8: 105,378,385 L560Q probably damaging Het
Prg4 C T 1: 150,449,999 W1217* probably null Het
Prkdc A G 16: 15,714,266 I1465V probably benign Het
Pus1 A G 5: 110,777,639 F105S probably damaging Het
Ranbp3l T C 15: 9,057,125 S154P probably damaging Het
Rhbdl1 C T 17: 25,835,539 G211S probably damaging Het
Rnf219 T C 14: 104,479,186 K584E probably benign Het
Rrp36 C T 17: 46,672,745 R47Q possibly damaging Het
Rtp1 T A 16: 23,431,410 I175N probably damaging Het
Sash1 T A 10: 8,727,908 N1127Y possibly damaging Het
Setbp1 C T 18: 78,858,362 E697K possibly damaging Het
Slc27a3 A T 3: 90,386,317 V587E probably benign Het
Slc38a2 A G 15: 96,691,162 F454L possibly damaging Het
Sprn A T 7: 140,153,545 probably benign Het
St14 A G 9: 31,089,870 V855A possibly damaging Het
Syt10 C T 15: 89,790,776 D456N probably damaging Het
Tbc1d1 A G 5: 64,311,221 E732G probably damaging Het
Tnfaip3 A G 10: 19,003,607 F671S possibly damaging Het
Tor1aip2 C A 1: 156,064,794 P282Q probably damaging Het
Ttc7b C T 12: 100,415,130 probably null Het
Ttll2 A T 17: 7,352,390 F46Y probably damaging Het
Ttn A G 2: 76,734,150 S28548P probably damaging Het
Tubb5 T C 17: 35,835,298 Y340C probably benign Het
Usp32 A T 11: 85,007,004 C1170* probably null Het
Usp54 G T 14: 20,560,904 H1281Q probably benign Het
Vgll4 C T 6: 114,921,335 G22S probably benign Het
Vmn2r120 T A 17: 57,524,839 I317F probably benign Het
Zdhhc5 A T 2: 84,693,427 F225Y probably damaging Het
Zfp652 A G 11: 95,764,025 E418G possibly damaging Het
Other mutations in Dmxl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Dmxl2 APN 9 54401704 missense probably benign
IGL00226:Dmxl2 APN 9 54415993 missense probably damaging 1.00
IGL00419:Dmxl2 APN 9 54406667 missense probably damaging 0.96
IGL00551:Dmxl2 APN 9 54450838 missense probably damaging 1.00
IGL00765:Dmxl2 APN 9 54415422 unclassified probably benign
IGL00852:Dmxl2 APN 9 54423313 nonsense probably null
IGL00857:Dmxl2 APN 9 54376320 missense probably benign 0.32
IGL00952:Dmxl2 APN 9 54416882 missense probably damaging 0.99
IGL01139:Dmxl2 APN 9 54458964 missense probably damaging 1.00
IGL01346:Dmxl2 APN 9 54415475 missense probably damaging 1.00
IGL01538:Dmxl2 APN 9 54445376 splice site probably benign
IGL01645:Dmxl2 APN 9 54378733 missense possibly damaging 0.93
IGL02096:Dmxl2 APN 9 54401065 missense possibly damaging 0.89
IGL02104:Dmxl2 APN 9 54404015 nonsense probably null
IGL02145:Dmxl2 APN 9 54374697 missense probably benign 0.29
IGL02210:Dmxl2 APN 9 54404049 missense probably damaging 1.00
IGL02238:Dmxl2 APN 9 54445433 missense probably damaging 1.00
IGL02255:Dmxl2 APN 9 54393768 missense probably benign 0.06
IGL02364:Dmxl2 APN 9 54393843 missense probably benign 0.02
IGL02423:Dmxl2 APN 9 54393748 missense possibly damaging 0.89
IGL02440:Dmxl2 APN 9 54406615 missense probably damaging 0.98
IGL02546:Dmxl2 APN 9 54366414 utr 3 prime probably benign
IGL02668:Dmxl2 APN 9 54416945 missense probably damaging 1.00
IGL03229:Dmxl2 APN 9 54404172 missense probably damaging 1.00
IGL03244:Dmxl2 APN 9 54416371 missense probably damaging 1.00
IGL03277:Dmxl2 APN 9 54404220 missense probably damaging 1.00
IGL03399:Dmxl2 APN 9 54446672 missense probably damaging 1.00
I2288:Dmxl2 UTSW 9 54401793 missense probably damaging 1.00
P0014:Dmxl2 UTSW 9 54401764 missense probably damaging 1.00
R0411:Dmxl2 UTSW 9 54378939 missense probably damaging 1.00
R0422:Dmxl2 UTSW 9 54399940 critical splice donor site probably null
R0432:Dmxl2 UTSW 9 54416951 missense probably benign 0.01
R0436:Dmxl2 UTSW 9 54383750 missense probably damaging 1.00
R0538:Dmxl2 UTSW 9 54393836 missense probably benign 0.06
R0603:Dmxl2 UTSW 9 54405906 missense possibly damaging 0.95
R0605:Dmxl2 UTSW 9 54419945 missense probably benign 0.01
R0625:Dmxl2 UTSW 9 54382702 missense probably benign
R0626:Dmxl2 UTSW 9 54416554 missense probably damaging 1.00
R0736:Dmxl2 UTSW 9 54378817 missense probably damaging 0.99
R0847:Dmxl2 UTSW 9 54405828 missense probably damaging 1.00
R0855:Dmxl2 UTSW 9 54366440 missense probably benign 0.03
R0962:Dmxl2 UTSW 9 54446412 missense probably damaging 0.99
R1015:Dmxl2 UTSW 9 54367765 missense probably benign 0.32
R1084:Dmxl2 UTSW 9 54416433 missense probably damaging 1.00
R1328:Dmxl2 UTSW 9 54396249 missense probably benign 0.12
R1401:Dmxl2 UTSW 9 54415428 critical splice donor site probably null
R1503:Dmxl2 UTSW 9 54446988 nonsense probably null
R1609:Dmxl2 UTSW 9 54409263 missense possibly damaging 0.90
R1613:Dmxl2 UTSW 9 54382027 missense probably benign
R1660:Dmxl2 UTSW 9 54451030 missense possibly damaging 0.68
R1712:Dmxl2 UTSW 9 54401485 missense probably benign 0.00
R1772:Dmxl2 UTSW 9 54423224 splice site probably benign
R1832:Dmxl2 UTSW 9 54460949 missense probably damaging 0.97
R2104:Dmxl2 UTSW 9 54415564 missense probably damaging 1.00
R2109:Dmxl2 UTSW 9 54393813 missense probably benign 0.06
R2145:Dmxl2 UTSW 9 54415910 missense probably damaging 1.00
R2199:Dmxl2 UTSW 9 54376243 missense probably benign 0.35
R2352:Dmxl2 UTSW 9 54393862 missense probably damaging 1.00
R2516:Dmxl2 UTSW 9 54400094 missense probably damaging 1.00
R2981:Dmxl2 UTSW 9 54393702 missense probably damaging 1.00
R3430:Dmxl2 UTSW 9 54477461 missense possibly damaging 0.94
R3625:Dmxl2 UTSW 9 54393643 missense probably benign 0.23
R3725:Dmxl2 UTSW 9 54393769 missense probably damaging 1.00
R3787:Dmxl2 UTSW 9 54369878 missense probably damaging 1.00
R4002:Dmxl2 UTSW 9 54473832 splice site probably benign
R4004:Dmxl2 UTSW 9 54446390 missense probably benign 0.04
R4005:Dmxl2 UTSW 9 54446390 missense probably benign 0.04
R4012:Dmxl2 UTSW 9 54379013 splice site probably null
R4014:Dmxl2 UTSW 9 54378709 splice site probably null
R4115:Dmxl2 UTSW 9 54446988 nonsense probably null
R4232:Dmxl2 UTSW 9 54419909 missense possibly damaging 0.89
R4388:Dmxl2 UTSW 9 54396267 missense probably damaging 1.00
R4513:Dmxl2 UTSW 9 54419884 missense probably null 0.17
R4552:Dmxl2 UTSW 9 54451763 missense probably damaging 1.00
R4609:Dmxl2 UTSW 9 54446512 missense probably damaging 1.00
R4625:Dmxl2 UTSW 9 54404120 missense possibly damaging 0.55
R4694:Dmxl2 UTSW 9 54446905 missense probably benign 0.04
R4711:Dmxl2 UTSW 9 54450924 missense probably benign 0.37
R4715:Dmxl2 UTSW 9 54446405 unclassified probably null
R4746:Dmxl2 UTSW 9 54451796 missense probably benign 0.04
R4789:Dmxl2 UTSW 9 54379815 missense probably benign 0.30
R4825:Dmxl2 UTSW 9 54404041 missense probably benign 0.01
R4911:Dmxl2 UTSW 9 54411653 missense probably damaging 1.00
R4995:Dmxl2 UTSW 9 54501441 utr 5 prime probably benign
R5026:Dmxl2 UTSW 9 54416676 missense probably damaging 1.00
R5118:Dmxl2 UTSW 9 54460987 missense probably damaging 1.00
R5174:Dmxl2 UTSW 9 54445484 unclassified probably null
R5288:Dmxl2 UTSW 9 54378757 missense probably benign
R5373:Dmxl2 UTSW 9 54369189 intron probably benign
R5374:Dmxl2 UTSW 9 54369189 intron probably benign
R5385:Dmxl2 UTSW 9 54378757 missense probably benign
R5386:Dmxl2 UTSW 9 54378757 missense probably benign
R5418:Dmxl2 UTSW 9 54374651 critical splice donor site probably null
R5540:Dmxl2 UTSW 9 54393857 missense probably benign 0.21
R5568:Dmxl2 UTSW 9 54423359 splice site probably null
R5733:Dmxl2 UTSW 9 54376266 missense possibly damaging 0.64
R5758:Dmxl2 UTSW 9 54472964 missense probably benign 0.28
R5759:Dmxl2 UTSW 9 54375508 missense probably damaging 1.00
R5893:Dmxl2 UTSW 9 54387420 missense possibly damaging 0.64
R6030:Dmxl2 UTSW 9 54393673 missense probably benign 0.18
R6030:Dmxl2 UTSW 9 54393673 missense probably benign 0.18
R6041:Dmxl2 UTSW 9 54416753 missense probably damaging 1.00
R6174:Dmxl2 UTSW 9 54393727 missense probably damaging 1.00
R6278:Dmxl2 UTSW 9 54415762 missense probably damaging 1.00
R6307:Dmxl2 UTSW 9 54382706 missense possibly damaging 0.68
R6349:Dmxl2 UTSW 9 54419909 missense possibly damaging 0.89
R6404:Dmxl2 UTSW 9 54375536 missense probably damaging 1.00
R6516:Dmxl2 UTSW 9 54416676 missense probably damaging 1.00
R6712:Dmxl2 UTSW 9 54411624 missense probably damaging 1.00
R6747:Dmxl2 UTSW 9 54416088 missense probably damaging 1.00
R6769:Dmxl2 UTSW 9 54416524 missense probably damaging 1.00
R6771:Dmxl2 UTSW 9 54416524 missense probably damaging 1.00
R6800:Dmxl2 UTSW 9 54409183 missense probably damaging 1.00
R6891:Dmxl2 UTSW 9 54480380 missense probably damaging 0.99
R6920:Dmxl2 UTSW 9 54472212 missense probably damaging 1.00
R6979:Dmxl2 UTSW 9 54450879 missense possibly damaging 0.49
R7147:Dmxl2 UTSW 9 54416729 missense probably benign 0.06
R7327:Dmxl2 UTSW 9 54401585 missense probably damaging 1.00
R7462:Dmxl2 UTSW 9 54366632 splice site probably null
R7526:Dmxl2 UTSW 9 54400957 missense possibly damaging 0.47
R7569:Dmxl2 UTSW 9 54415987 missense possibly damaging 0.51
R7622:Dmxl2 UTSW 9 54472218 missense probably damaging 0.99
R7638:Dmxl2 UTSW 9 54457794 missense unknown
R7703:Dmxl2 UTSW 9 54461086 missense probably benign 0.01
R7768:Dmxl2 UTSW 9 54380939 missense probably damaging 1.00
R8007:Dmxl2 UTSW 9 54383691 nonsense probably null
X0064:Dmxl2 UTSW 9 54401713 missense probably benign
Z1177:Dmxl2 UTSW 9 54382034 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGAGTTGTTCAGCAATCACATCG -3'
(R):5'- TGTCCTGTTTTAGCCCTTGAAG -3'

Sequencing Primer
(F):5'- ATCGACCTCAGTATCGCCG -3'
(R):5'- AAAGATCAGCTTGACTCTGTTTCTGG -3'
Posted On2014-07-14