Incidental Mutation 'R1922:Sash1'
ID213158
Institutional Source Beutler Lab
Gene Symbol Sash1
Ensembl Gene ENSMUSG00000015305
Gene NameSAM and SH3 domain containing 1
Synonyms
MMRRC Submission 039940-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1922 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location8722219-8886070 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 8727908 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 1127 (N1127Y)
Ref Sequence ENSEMBL: ENSMUSP00000015449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015449]
Predicted Effect possibly damaging
Transcript: ENSMUST00000015449
AA Change: N1127Y

PolyPhen 2 Score 0.619 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000015449
Gene: ENSMUSG00000015305
AA Change: N1127Y

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
coiled coil region 185 212 N/A INTRINSIC
low complexity region 323 336 N/A INTRINSIC
Pfam:SLY 394 548 1.2e-46 PFAM
SH3 550 607 1.16e-3 SMART
SAM 623 690 1.83e-11 SMART
low complexity region 1008 1021 N/A INTRINSIC
SAM 1157 1224 3.6e-10 SMART
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.1%
  • 10x: 95.8%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a scaffold protein involved in the TLR4 signaling pathway that may stimulate cytokine production and endothelial cell migration in response to invading pathogens. The encoded protein has also been described as a potential tumor suppressor that may negatively regulate proliferation, apoptosis, and invasion of cancer cells, and reduced expression of this gene has been observed in multiple human cancers. Mutations in this gene may be associated with abnormal skin pigmentation in human patients. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A C 6: 48,931,286 I407L probably benign Het
Abca12 G T 1: 71,319,924 N574K probably benign Het
Adcy9 A T 16: 4,311,657 L455H probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Amy1 T A 3: 113,564,895 I163F probably damaging Het
Armc5 A G 7: 128,240,505 S332G probably benign Het
Brd4 T C 17: 32,198,086 probably benign Het
Cadps T C 14: 12,465,859 K1017R possibly damaging Het
Cfap45 A G 1: 172,545,112 E458G probably damaging Het
Chrna1 A G 2: 73,568,232 S288P probably damaging Het
Cpe T A 8: 64,617,689 D174V probably benign Het
Dclre1c T C 2: 3,440,782 F235L possibly damaging Het
Ddx20 A T 3: 105,678,584 V815D probably damaging Het
Dhx9 T C 1: 153,460,274 probably null Het
Dmxl2 A C 9: 54,401,523 H1981Q probably benign Het
Doc2a A C 7: 126,851,431 D293A probably damaging Het
Eif2a C T 3: 58,548,530 R317C probably damaging Het
Fancc A G 13: 63,330,567 V318A possibly damaging Het
Fes A T 7: 80,383,986 Y172* probably null Het
Gipc3 T A 10: 81,338,215 I242F probably damaging Het
Glul G A 1: 153,907,324 M214I probably benign Het
Gm14496 A G 2: 182,001,004 I823V probably benign Het
Gm6665 T C 18: 31,820,265 N50S probably benign Het
Gm6729 T C 10: 86,540,918 noncoding transcript Het
Gpr21 T A 2: 37,518,338 C299S probably damaging Het
Hapln2 T A 3: 88,023,377 N196Y probably benign Het
Hsd17b12 A G 2: 94,045,392 V196A probably benign Het
Kalrn A T 16: 34,392,093 D28E probably benign Het
Kansl1 A T 11: 104,343,640 L680Q probably damaging Het
Kcna3 T C 3: 107,037,935 S505P possibly damaging Het
Klra1 A C 6: 130,372,865 N203K probably benign Het
L3mbtl2 T A 15: 81,675,621 I236N probably damaging Het
Mcm3ap C A 10: 76,507,361 P1696T probably damaging Het
Mecom T C 3: 29,957,442 D647G probably damaging Het
Mn1 A G 5: 111,418,746 D194G probably damaging Het
Muc5ac A G 7: 141,793,689 N407S probably benign Het
Mx2 C T 16: 97,560,351 R584C probably benign Het
Myo1c A G 11: 75,668,229 R597G probably benign Het
Nav3 T C 10: 109,705,606 D1932G probably benign Het
Nwd2 T A 5: 63,794,242 D205E probably benign Het
Olfr1353 T A 10: 78,970,141 L164* probably null Het
Olfr885 T C 9: 38,061,685 Y122H probably damaging Het
Osmr T C 15: 6,844,367 E183G possibly damaging Het
Peak1 A T 9: 56,206,687 W627R probably damaging Het
Pkd1 C A 17: 24,595,157 P4167Q probably damaging Het
Plekhg4 T A 8: 105,378,385 L560Q probably damaging Het
Prg4 C T 1: 150,449,999 W1217* probably null Het
Prkdc A G 16: 15,714,266 I1465V probably benign Het
Pus1 A G 5: 110,777,639 F105S probably damaging Het
Ranbp3l T C 15: 9,057,125 S154P probably damaging Het
Rhbdl1 C T 17: 25,835,539 G211S probably damaging Het
Rnf219 T C 14: 104,479,186 K584E probably benign Het
Rrp36 C T 17: 46,672,745 R47Q possibly damaging Het
Rtp1 T A 16: 23,431,410 I175N probably damaging Het
Setbp1 C T 18: 78,858,362 E697K possibly damaging Het
Slc27a3 A T 3: 90,386,317 V587E probably benign Het
Slc38a2 A G 15: 96,691,162 F454L possibly damaging Het
Sprn A T 7: 140,153,545 probably benign Het
St14 A G 9: 31,089,870 V855A possibly damaging Het
Syt10 C T 15: 89,790,776 D456N probably damaging Het
Tbc1d1 A G 5: 64,311,221 E732G probably damaging Het
Tnfaip3 A G 10: 19,003,607 F671S possibly damaging Het
Tor1aip2 C A 1: 156,064,794 P282Q probably damaging Het
Ttc7b C T 12: 100,415,130 probably null Het
Ttll2 A T 17: 7,352,390 F46Y probably damaging Het
Ttn A G 2: 76,734,150 S28548P probably damaging Het
Tubb5 T C 17: 35,835,298 Y340C probably benign Het
Usp32 A T 11: 85,007,004 C1170* probably null Het
Usp54 G T 14: 20,560,904 H1281Q probably benign Het
Vgll4 C T 6: 114,921,335 G22S probably benign Het
Vmn2r120 T A 17: 57,524,839 I317F probably benign Het
Zdhhc5 A T 2: 84,693,427 F225Y probably damaging Het
Zfp652 A G 11: 95,764,025 E418G possibly damaging Het
Other mutations in Sash1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00987:Sash1 APN 10 8751413 missense probably damaging 1.00
IGL01535:Sash1 APN 10 8741577 missense probably damaging 1.00
IGL01537:Sash1 APN 10 8729658 missense probably damaging 1.00
IGL01788:Sash1 APN 10 8733646 missense probably benign 0.01
IGL01933:Sash1 APN 10 8751133 missense probably damaging 0.99
IGL02126:Sash1 APN 10 8739465 missense probably damaging 0.96
IGL02285:Sash1 APN 10 8740334 missense probably damaging 0.99
IGL02400:Sash1 APN 10 8733647 nonsense probably null
IGL02504:Sash1 APN 10 8729912 missense probably benign 0.00
IGL02630:Sash1 APN 10 8744535 missense probably benign 0.06
boyscout UTSW 10 8742422 splice site probably null
cubscout UTSW 10 8729713 missense probably benign 0.01
R0592:Sash1 UTSW 10 8729782 missense probably benign 0.00
R0647:Sash1 UTSW 10 8729552 missense probably damaging 0.99
R0656:Sash1 UTSW 10 8751137 critical splice donor site probably null
R0830:Sash1 UTSW 10 8729909 missense probably benign 0.01
R0919:Sash1 UTSW 10 8730079 missense probably benign 0.01
R1470:Sash1 UTSW 10 8789593 missense probably damaging 1.00
R1470:Sash1 UTSW 10 8789593 missense probably damaging 1.00
R1606:Sash1 UTSW 10 8729957 missense probably benign 0.00
R1707:Sash1 UTSW 10 8730377 missense probably benign 0.00
R1940:Sash1 UTSW 10 8729932 missense probably benign
R1964:Sash1 UTSW 10 8729713 missense probably benign 0.01
R2013:Sash1 UTSW 10 8729413 missense probably benign 0.03
R2014:Sash1 UTSW 10 8729413 missense probably benign 0.03
R2015:Sash1 UTSW 10 8729413 missense probably benign 0.03
R2074:Sash1 UTSW 10 8756697 missense probably damaging 1.00
R2252:Sash1 UTSW 10 8729977 missense probably benign 0.01
R2253:Sash1 UTSW 10 8729977 missense probably benign 0.01
R2260:Sash1 UTSW 10 8786378 nonsense probably null
R3085:Sash1 UTSW 10 8742422 splice site probably null
R4024:Sash1 UTSW 10 8729917 missense probably benign 0.00
R4039:Sash1 UTSW 10 8729627 missense probably damaging 1.00
R4290:Sash1 UTSW 10 8730242 missense possibly damaging 0.59
R4292:Sash1 UTSW 10 8730242 missense possibly damaging 0.59
R4295:Sash1 UTSW 10 8730242 missense possibly damaging 0.59
R4301:Sash1 UTSW 10 8751470 missense probably benign 0.00
R4657:Sash1 UTSW 10 8725660 missense probably damaging 1.00
R4669:Sash1 UTSW 10 8730385 missense probably benign 0.00
R4719:Sash1 UTSW 10 8729713 missense probably benign 0.01
R4745:Sash1 UTSW 10 8729908 missense probably benign
R5197:Sash1 UTSW 10 8740225 missense probably damaging 1.00
R5217:Sash1 UTSW 10 8780604 missense possibly damaging 0.63
R5420:Sash1 UTSW 10 8746186 missense probably damaging 1.00
R5591:Sash1 UTSW 10 8725718 missense probably benign 0.36
R6505:Sash1 UTSW 10 8729527 missense probably benign 0.21
R6679:Sash1 UTSW 10 8740185 missense probably damaging 1.00
R6761:Sash1 UTSW 10 8744522 missense probably damaging 0.99
R6885:Sash1 UTSW 10 8784221 missense probably damaging 1.00
R6980:Sash1 UTSW 10 8729848 missense probably benign 0.00
R7034:Sash1 UTSW 10 8730083 nonsense probably null
R7036:Sash1 UTSW 10 8730083 nonsense probably null
R7088:Sash1 UTSW 10 8729717 nonsense probably null
R7289:Sash1 UTSW 10 8730196 missense probably damaging 0.99
R7464:Sash1 UTSW 10 8756745 missense possibly damaging 0.82
R7661:Sash1 UTSW 10 8729391 missense probably benign 0.01
R7752:Sash1 UTSW 10 8780564 nonsense probably null
R7856:Sash1 UTSW 10 8729708 missense probably benign 0.00
R7901:Sash1 UTSW 10 8780564 nonsense probably null
R8152:Sash1 UTSW 10 8751041 missense possibly damaging 0.94
R8218:Sash1 UTSW 10 8751236 missense probably damaging 0.99
R8317:Sash1 UTSW 10 8729386 missense possibly damaging 0.76
R8358:Sash1 UTSW 10 8729981 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCTGTTCTAATAGGCATAAAACCCAG -3'
(R):5'- AAACCCCGGGTGTTACTTCC -3'

Sequencing Primer
(F):5'- AATCCAAGTCTAGGCTGACAG -3'
(R):5'- ACTTCCTGATAGCTAAGCTGTG -3'
Posted On2014-07-14