Incidental Mutation 'R1922:Gm6729'
ID 213163
Institutional Source Beutler Lab
Gene Symbol Gm6729
Ensembl Gene ENSMUSG00000090816
Gene Name predicted gene 6729
Synonyms
MMRRC Submission 039940-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.076) question?
Stock # R1922 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 86362161-86377447 bp(-) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) T to C at 86376782 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
AlphaFold no structure available at present
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165173
SMART Domains Protein: ENSMUSP00000133178
Gene: ENSMUSG00000090816

DomainStartEndE-ValueType
S_TKc 14 262 4.3e-87 SMART
UBA 276 313 2.99e-4 SMART
low complexity region 327 341 N/A INTRINSIC
low complexity region 450 465 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219485
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.1%
  • 10x: 95.8%
  • 20x: 93.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 G T 1: 71,359,083 (GRCm39) N574K probably benign Het
Adcy9 A T 16: 4,129,521 (GRCm39) L455H probably damaging Het
Alkbh2 C T 5: 114,262,287 (GRCm39) E148K probably damaging Het
Amy1 T A 3: 113,358,544 (GRCm39) I163F probably damaging Het
Aoc1l2 A C 6: 48,908,220 (GRCm39) I407L probably benign Het
Armc5 A G 7: 127,839,677 (GRCm39) S332G probably benign Het
Brd4 T C 17: 32,417,060 (GRCm39) probably benign Het
Cadps T C 14: 12,465,859 (GRCm38) K1017R possibly damaging Het
Cfap45 A G 1: 172,372,679 (GRCm39) E458G probably damaging Het
Chrna1 A G 2: 73,398,576 (GRCm39) S288P probably damaging Het
Cpe T A 8: 65,070,723 (GRCm39) D174V probably benign Het
Dclre1c T C 2: 3,441,819 (GRCm39) F235L possibly damaging Het
Ddx20 A T 3: 105,585,900 (GRCm39) V815D probably damaging Het
Dhx9 T C 1: 153,336,020 (GRCm39) probably null Het
Dmxl2 A C 9: 54,308,807 (GRCm39) H1981Q probably benign Het
Doc2a A C 7: 126,450,603 (GRCm39) D293A probably damaging Het
Eif2a C T 3: 58,455,951 (GRCm39) R317C probably damaging Het
Fancc A G 13: 63,478,381 (GRCm39) V318A possibly damaging Het
Fes A T 7: 80,033,734 (GRCm39) Y172* probably null Het
Gipc3 T A 10: 81,174,049 (GRCm39) I242F probably damaging Het
Glul G A 1: 153,783,070 (GRCm39) M214I probably benign Het
Gm14496 A G 2: 181,642,797 (GRCm39) I823V probably benign Het
Gm6665 T C 18: 31,953,318 (GRCm39) N50S probably benign Het
Gpr21 T A 2: 37,408,350 (GRCm39) C299S probably damaging Het
Hapln2 T A 3: 87,930,684 (GRCm39) N196Y probably benign Het
Hsd17b12 A G 2: 93,875,737 (GRCm39) V196A probably benign Het
Kalrn A T 16: 34,212,463 (GRCm39) D28E probably benign Het
Kansl1 A T 11: 104,234,466 (GRCm39) L680Q probably damaging Het
Kcna3 T C 3: 106,945,251 (GRCm39) S505P possibly damaging Het
Klra1 A C 6: 130,349,828 (GRCm39) N203K probably benign Het
L3mbtl2 T A 15: 81,559,822 (GRCm39) I236N probably damaging Het
Mcm3ap C A 10: 76,343,195 (GRCm39) P1696T probably damaging Het
Mecom T C 3: 30,011,591 (GRCm39) D647G probably damaging Het
Mn1 A G 5: 111,566,612 (GRCm39) D194G probably damaging Het
Muc5ac A G 7: 141,347,426 (GRCm39) N407S probably benign Het
Mx2 C T 16: 97,361,551 (GRCm39) R584C probably benign Het
Myo1c A G 11: 75,559,055 (GRCm39) R597G probably benign Het
Nav3 T C 10: 109,541,467 (GRCm39) D1932G probably benign Het
Nwd2 T A 5: 63,951,585 (GRCm39) D205E probably benign Het
Obi1 T C 14: 104,716,622 (GRCm39) K584E probably benign Het
Or7a37 T A 10: 78,805,975 (GRCm39) L164* probably null Het
Or8b38 T C 9: 37,972,981 (GRCm39) Y122H probably damaging Het
Osmr T C 15: 6,873,848 (GRCm39) E183G possibly damaging Het
Peak1 A T 9: 56,113,971 (GRCm39) W627R probably damaging Het
Pkd1 C A 17: 24,814,131 (GRCm39) P4167Q probably damaging Het
Plekhg4 T A 8: 106,105,017 (GRCm39) L560Q probably damaging Het
Prg4 C T 1: 150,325,750 (GRCm39) W1217* probably null Het
Prkdc A G 16: 15,532,130 (GRCm39) I1465V probably benign Het
Pus1 A G 5: 110,925,505 (GRCm39) F105S probably damaging Het
Ranbp3l T C 15: 9,057,206 (GRCm39) S154P probably damaging Het
Rhbdl1 C T 17: 26,054,513 (GRCm39) G211S probably damaging Het
Rrp36 C T 17: 46,983,671 (GRCm39) R47Q possibly damaging Het
Rtp1 T A 16: 23,250,160 (GRCm39) I175N probably damaging Het
Sash1 T A 10: 8,603,672 (GRCm39) N1127Y possibly damaging Het
Setbp1 C T 18: 78,901,577 (GRCm39) E697K possibly damaging Het
Slc27a3 A T 3: 90,293,624 (GRCm39) V587E probably benign Het
Slc38a2 A G 15: 96,589,043 (GRCm39) F454L possibly damaging Het
Sprn A T 7: 139,733,458 (GRCm39) probably benign Het
St14 A G 9: 31,001,166 (GRCm39) V855A possibly damaging Het
Syt10 C T 15: 89,674,979 (GRCm39) D456N probably damaging Het
Tbc1d1 A G 5: 64,468,564 (GRCm39) E732G probably damaging Het
Tnfaip3 A G 10: 18,879,355 (GRCm39) F671S possibly damaging Het
Tor1aip2 C A 1: 155,940,540 (GRCm39) P282Q probably damaging Het
Ttc7b C T 12: 100,381,389 (GRCm39) probably null Het
Ttll2 A T 17: 7,619,789 (GRCm39) F46Y probably damaging Het
Ttn A G 2: 76,564,494 (GRCm39) S28548P probably damaging Het
Tubb5 T C 17: 36,146,190 (GRCm39) Y340C probably benign Het
Usp32 A T 11: 84,897,830 (GRCm39) C1170* probably null Het
Usp54 G T 14: 20,610,972 (GRCm39) H1281Q probably benign Het
Vgll4 C T 6: 114,898,296 (GRCm39) G22S probably benign Het
Vmn2r120 T A 17: 57,831,839 (GRCm39) I317F probably benign Het
Zdhhc5 A T 2: 84,523,771 (GRCm39) F225Y probably damaging Het
Zfp652 A G 11: 95,654,851 (GRCm39) E418G possibly damaging Het
Other mutations in Gm6729
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0906:Gm6729 UTSW 10 86,376,456 (GRCm39) unclassified noncoding transcript
R1034:Gm6729 UTSW 10 86,375,890 (GRCm39) unclassified noncoding transcript
R1052:Gm6729 UTSW 10 86,376,799 (GRCm39) unclassified noncoding transcript
R1523:Gm6729 UTSW 10 86,376,039 (GRCm39) unclassified noncoding transcript
R3498:Gm6729 UTSW 10 86,376,582 (GRCm39) unclassified noncoding transcript
R4133:Gm6729 UTSW 10 86,377,030 (GRCm39) unclassified noncoding transcript
R4193:Gm6729 UTSW 10 86,376,483 (GRCm39) unclassified noncoding transcript
R4940:Gm6729 UTSW 10 86,376,252 (GRCm39) unclassified noncoding transcript
X0028:Gm6729 UTSW 10 86,376,648 (GRCm39) unclassified noncoding transcript
Predicted Primers PCR Primer
(F):5'- TCTTTGAAGGTGATTCCGGC -3'
(R):5'- ACGTCAACTTCATACTGGAGTAC -3'

Sequencing Primer
(F):5'- CTTTGAAGGTGATTCCGGCAAAGG -3'
(R):5'- ACTTCATACTGGAGTACGCATCGG -3'
Posted On 2014-07-14