Incidental Mutation 'R1922:Zfp652'
ID213167
Institutional Source Beutler Lab
Gene Symbol Zfp652
Ensembl Gene ENSMUSG00000075595
Gene Namezinc finger protein 652
Synonyms9530033F24Rik
MMRRC Submission 039940-MU
Accession Numbers

Ncbi RefSeq: NM_201609.2; MGI:2442221

Is this an essential gene? Probably essential (E-score: 0.799) question?
Stock #R1922 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location95712673-95835115 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 95764025 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 418 (E418G)
Ref Sequence ENSEMBL: ENSMUSP00000115393 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091565] [ENSMUST00000107717] [ENSMUST00000133070] [ENSMUST00000148945]
Predicted Effect possibly damaging
Transcript: ENSMUST00000091565
AA Change: E598G

PolyPhen 2 Score 0.615 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000089153
Gene: ENSMUSG00000075595
AA Change: E598G

DomainStartEndE-ValueType
low complexity region 95 108 N/A INTRINSIC
low complexity region 148 167 N/A INTRINSIC
low complexity region 173 213 N/A INTRINSIC
low complexity region 220 231 N/A INTRINSIC
ZnF_C2H2 244 267 7.9e-4 SMART
ZnF_C2H2 271 291 6.15e1 SMART
ZnF_C2H2 298 321 1.76e-1 SMART
ZnF_C2H2 328 350 2.53e-2 SMART
ZnF_C2H2 356 378 6.78e-3 SMART
ZnF_C2H2 384 406 2.95e-3 SMART
ZnF_C2H2 412 434 1.95e-3 SMART
ZnF_C2H2 440 462 1.15e-5 SMART
ZnF_C2H2 468 488 6.15e1 SMART
low complexity region 508 529 N/A INTRINSIC
low complexity region 544 576 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107717
AA Change: E598G

PolyPhen 2 Score 0.615 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000103345
Gene: ENSMUSG00000075595
AA Change: E598G

DomainStartEndE-ValueType
low complexity region 95 108 N/A INTRINSIC
low complexity region 148 167 N/A INTRINSIC
low complexity region 173 213 N/A INTRINSIC
low complexity region 220 231 N/A INTRINSIC
ZnF_C2H2 244 267 7.9e-4 SMART
ZnF_C2H2 271 291 6.15e1 SMART
ZnF_C2H2 298 321 1.76e-1 SMART
ZnF_C2H2 328 350 2.53e-2 SMART
ZnF_C2H2 356 378 6.78e-3 SMART
ZnF_C2H2 384 406 2.95e-3 SMART
ZnF_C2H2 412 434 1.95e-3 SMART
ZnF_C2H2 440 462 1.15e-5 SMART
ZnF_C2H2 468 488 6.15e1 SMART
low complexity region 508 529 N/A INTRINSIC
low complexity region 544 576 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120170
Predicted Effect probably benign
Transcript: ENSMUST00000133070
SMART Domains Protein: ENSMUSP00000122280
Gene: ENSMUSG00000075595

DomainStartEndE-ValueType
low complexity region 95 108 N/A INTRINSIC
low complexity region 148 167 N/A INTRINSIC
low complexity region 173 213 N/A INTRINSIC
low complexity region 220 231 N/A INTRINSIC
ZnF_C2H2 244 267 7.9e-4 SMART
ZnF_C2H2 271 291 6.15e1 SMART
ZnF_C2H2 298 321 1.76e-1 SMART
ZnF_C2H2 328 350 2.53e-2 SMART
ZnF_C2H2 356 378 6.78e-3 SMART
ZnF_C2H2 384 406 2.95e-3 SMART
ZnF_C2H2 412 434 1.95e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000148945
AA Change: E418G

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000115393
Gene: ENSMUSG00000075595
AA Change: E418G

DomainStartEndE-ValueType
low complexity region 95 108 N/A INTRINSIC
ZnF_C2H2 118 141 4.34e-1 SMART
ZnF_C2H2 148 170 2.53e-2 SMART
ZnF_C2H2 176 198 6.78e-3 SMART
ZnF_C2H2 204 226 2.95e-3 SMART
ZnF_C2H2 232 254 1.95e-3 SMART
ZnF_C2H2 260 282 1.15e-5 SMART
ZnF_C2H2 288 308 6.15e1 SMART
low complexity region 328 349 N/A INTRINSIC
low complexity region 364 396 N/A INTRINSIC
Meta Mutation Damage Score 0.088 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.1%
  • 10x: 95.8%
  • 20x: 93.7%
Validation Efficiency
Allele List at MGI

All alleles(23) : Targeted(1) Gene trapped(22)

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A C 6: 48,931,286 I407L probably benign Het
Abca12 G T 1: 71,319,924 N574K probably benign Het
Adcy9 A T 16: 4,311,657 L455H probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Amy1 T A 3: 113,564,895 I163F probably damaging Het
Armc5 A G 7: 128,240,505 S332G probably benign Het
Brd4 T C 17: 32,198,086 probably benign Het
Cadps T C 14: 12,465,859 K1017R possibly damaging Het
Cfap45 A G 1: 172,545,112 E458G probably damaging Het
Chrna1 A G 2: 73,568,232 S288P probably damaging Het
Cpe T A 8: 64,617,689 D174V probably benign Het
Dclre1c T C 2: 3,440,782 F235L possibly damaging Het
Ddx20 A T 3: 105,678,584 V815D probably damaging Het
Dhx9 T C 1: 153,460,274 probably null Het
Dmxl2 A C 9: 54,401,523 H1981Q probably benign Het
Doc2a A C 7: 126,851,431 D293A probably damaging Het
Eif2a C T 3: 58,548,530 R317C probably damaging Het
Fancc A G 13: 63,330,567 V318A possibly damaging Het
Fes A T 7: 80,383,986 Y172* probably null Het
Gipc3 T A 10: 81,338,215 I242F probably damaging Het
Glul G A 1: 153,907,324 M214I probably benign Het
Gm14496 A G 2: 182,001,004 I823V probably benign Het
Gm6665 T C 18: 31,820,265 N50S probably benign Het
Gm6729 T C 10: 86,540,918 noncoding transcript Het
Gpr21 T A 2: 37,518,338 C299S probably damaging Het
Hapln2 T A 3: 88,023,377 N196Y probably benign Het
Hsd17b12 A G 2: 94,045,392 V196A probably benign Het
Kalrn A T 16: 34,392,093 D28E probably benign Het
Kansl1 A T 11: 104,343,640 L680Q probably damaging Het
Kcna3 T C 3: 107,037,935 S505P possibly damaging Het
Klra1 A C 6: 130,372,865 N203K probably benign Het
L3mbtl2 T A 15: 81,675,621 I236N probably damaging Het
Mcm3ap C A 10: 76,507,361 P1696T probably damaging Het
Mecom T C 3: 29,957,442 D647G probably damaging Het
Mn1 A G 5: 111,418,746 D194G probably damaging Het
Muc5ac A G 7: 141,793,689 N407S probably benign Het
Mx2 C T 16: 97,560,351 R584C probably benign Het
Myo1c A G 11: 75,668,229 R597G probably benign Het
Nav3 T C 10: 109,705,606 D1932G probably benign Het
Nwd2 T A 5: 63,794,242 D205E probably benign Het
Olfr1353 T A 10: 78,970,141 L164* probably null Het
Olfr885 T C 9: 38,061,685 Y122H probably damaging Het
Osmr T C 15: 6,844,367 E183G possibly damaging Het
Peak1 A T 9: 56,206,687 W627R probably damaging Het
Pkd1 C A 17: 24,595,157 P4167Q probably damaging Het
Plekhg4 T A 8: 105,378,385 L560Q probably damaging Het
Prg4 C T 1: 150,449,999 W1217* probably null Het
Prkdc A G 16: 15,714,266 I1465V probably benign Het
Pus1 A G 5: 110,777,639 F105S probably damaging Het
Ranbp3l T C 15: 9,057,125 S154P probably damaging Het
Rhbdl1 C T 17: 25,835,539 G211S probably damaging Het
Rnf219 T C 14: 104,479,186 K584E probably benign Het
Rrp36 C T 17: 46,672,745 R47Q possibly damaging Het
Rtp1 T A 16: 23,431,410 I175N probably damaging Het
Sash1 T A 10: 8,727,908 N1127Y possibly damaging Het
Setbp1 C T 18: 78,858,362 E697K possibly damaging Het
Slc27a3 A T 3: 90,386,317 V587E probably benign Het
Slc38a2 A G 15: 96,691,162 F454L possibly damaging Het
Sprn A T 7: 140,153,545 probably benign Het
St14 A G 9: 31,089,870 V855A possibly damaging Het
Syt10 C T 15: 89,790,776 D456N probably damaging Het
Tbc1d1 A G 5: 64,311,221 E732G probably damaging Het
Tnfaip3 A G 10: 19,003,607 F671S possibly damaging Het
Tor1aip2 C A 1: 156,064,794 P282Q probably damaging Het
Ttc7b C T 12: 100,415,130 probably null Het
Ttll2 A T 17: 7,352,390 F46Y probably damaging Het
Ttn A G 2: 76,734,150 S28548P probably damaging Het
Tubb5 T C 17: 35,835,298 Y340C probably benign Het
Usp32 A T 11: 85,007,004 C1170* probably null Het
Usp54 G T 14: 20,560,904 H1281Q probably benign Het
Vgll4 C T 6: 114,921,335 G22S probably benign Het
Vmn2r120 T A 17: 57,524,839 I317F probably benign Het
Zdhhc5 A T 2: 84,693,427 F225Y probably damaging Het
Other mutations in Zfp652
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0023:Zfp652 UTSW 11 95753469 nonsense probably null
R0023:Zfp652 UTSW 11 95753469 nonsense probably null
R0432:Zfp652 UTSW 11 95763739 missense possibly damaging 0.50
R0464:Zfp652 UTSW 11 95763649 missense probably damaging 0.99
R1146:Zfp652 UTSW 11 95749782 missense possibly damaging 0.86
R1146:Zfp652 UTSW 11 95749782 missense possibly damaging 0.86
R1920:Zfp652 UTSW 11 95764025 missense possibly damaging 0.73
R2090:Zfp652 UTSW 11 95754008 missense probably benign 0.14
R2290:Zfp652 UTSW 11 95750023 missense possibly damaging 0.58
R2656:Zfp652 UTSW 11 95749329 missense probably damaging 0.98
R4790:Zfp652 UTSW 11 95749609 missense probably damaging 0.99
R5073:Zfp652 UTSW 11 95750064 missense possibly damaging 0.65
R5098:Zfp652 UTSW 11 95752936 missense probably damaging 1.00
R5209:Zfp652 UTSW 11 95763665 missense possibly damaging 0.66
R5569:Zfp652 UTSW 11 95749290 missense probably benign
R5905:Zfp652 UTSW 11 95749863 missense probably benign
R6026:Zfp652 UTSW 11 95749962 missense possibly damaging 0.95
R6054:Zfp652 UTSW 11 95749863 missense probably benign
R6629:Zfp652 UTSW 11 95763790 missense probably damaging 0.96
R6815:Zfp652 UTSW 11 95749404 nonsense probably null
R6932:Zfp652 UTSW 11 95763841 missense probably benign
R7384:Zfp652 UTSW 11 95753004 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACCAGCCCAGTGAATGTG -3'
(R):5'- GTGGTTCCCCTGGTTTCAAG -3'

Sequencing Primer
(F):5'- AGCCCCTGCAGTCAGTATGAG -3'
(R):5'- TCAAGGGCAGTCGTCGTCTTC -3'
Posted On2014-07-14