Mutagenetix > Incidental Mutations

Incidental Mutation 'R1922:Kansl1'

213169

Institutional Source

Beutler Lab

Gene Symbol

Kansl1

Ensembl Gene

ENSMUSG00000018412

Gene Name

KAT8 regulatory NSL complex subunit 1

Synonyms

1700081L11Rik

MMRRC Submission

039940-MU

Accession Numbers

Genbank: NM_001081045.1; Ensembl: ENSMUST00000018556, ENSMUST00000035872, ENSMUST00000106971, ENSMUST00000106972, ENSMUST00000106974, ENSMUST00000106977, ENSMUST00000134266, ENSMUST00000166536

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1922 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

104333229-104468861 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 104343640 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 680 (L680Q)

Ref Sequence

ENSEMBL: ENSMUSP00000102590 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018556] [ENSMUST00000106971] [ENSMUST00000106972] [ENSMUST00000106977]

Predicted Effect

probably damaging
Transcript: ENSMUST00000018556
AA Change: L680Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000018556
Gene: ENSMUSG00000018412
AA Change: L680Q

Domain	Start	End	E-Value	Type
low complexity region	2	15	N/A	INTRINSIC
low complexity region	164	175	N/A	INTRINSIC
low complexity region	245	256	N/A	INTRINSIC
coiled coil region	283	311	N/A	INTRINSIC
low complexity region	404	417	N/A	INTRINSIC
low complexity region	759	772	N/A	INTRINSIC
PEHE	816	966	1.53e-53	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000069188

Predicted Effect

probably damaging
Transcript: ENSMUST00000106971
AA Change: L680Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000102584
Gene: ENSMUSG00000018412
AA Change: L680Q

Domain	Start	End	E-Value	Type
low complexity region	2	15	N/A	INTRINSIC
low complexity region	164	175	N/A	INTRINSIC
low complexity region	245	256	N/A	INTRINSIC
coiled coil region	283	311	N/A	INTRINSIC
low complexity region	404	417	N/A	INTRINSIC
low complexity region	822	835	N/A	INTRINSIC
PEHE	879	1029	1.53e-53	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000106972
AA Change: L680Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000102585
Gene: ENSMUSG00000018412
AA Change: L680Q

Domain	Start	End	E-Value	Type
low complexity region	2	15	N/A	INTRINSIC
low complexity region	164	175	N/A	INTRINSIC
low complexity region	245	256	N/A	INTRINSIC
coiled coil region	283	311	N/A	INTRINSIC
low complexity region	404	417	N/A	INTRINSIC
low complexity region	822	835	N/A	INTRINSIC
PEHE	879	1029	1.53e-53	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000106977
AA Change: L680Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000102590
Gene: ENSMUSG00000018412
AA Change: L680Q

Domain	Start	End	E-Value	Type
low complexity region	2	15	N/A	INTRINSIC
low complexity region	164	175	N/A	INTRINSIC
low complexity region	245	256	N/A	INTRINSIC
coiled coil region	283	311	N/A	INTRINSIC
low complexity region	404	417	N/A	INTRINSIC
low complexity region	759	772	N/A	INTRINSIC
PEHE	816	966	1.53e-53	SMART

Coding Region Coverage

1x: 97.5%
3x: 97.1%
10x: 95.8%
20x: 93.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein that is a subunit of two protein complexes involved with histone acetylation, the MLL1 complex and the NSL1 complex. The corresponding protein in Drosophila interacts with K(lysine) acetyltransferase 8, which is also a subunit of both the MLL1 and NSL1 complexes. [provided by RefSeq, Jun 2012]

Allele List at MGI

All alleles(136) : Gene trapped(136)

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600015I10Rik	A	C	6: 48,931,286	I407L	probably benign	Het
Abca12	G	T	1: 71,319,924	N574K	probably benign	Het
Adcy9	A	T	16: 4,311,657	L455H	probably damaging	Het
Alkbh2	C	T	5: 114,124,226	E148K	probably damaging	Het
Amy1	T	A	3: 113,564,895	I163F	probably damaging	Het
Armc5	A	G	7: 128,240,505	S332G	probably benign	Het
Brd4	T	C	17: 32,198,086		probably benign	Het
Cadps	T	C	14: 12,465,859	K1017R	possibly damaging	Het
Cfap45	A	G	1: 172,545,112	E458G	probably damaging	Het
Chrna1	A	G	2: 73,568,232	S288P	probably damaging	Het
Cpe	T	A	8: 64,617,689	D174V	probably benign	Het
Dclre1c	T	C	2: 3,440,782	F235L	possibly damaging	Het
Ddx20	A	T	3: 105,678,584	V815D	probably damaging	Het
Dhx9	T	C	1: 153,460,274		probably null	Het
Dmxl2	A	C	9: 54,401,523	H1981Q	probably benign	Het
Doc2a	A	C	7: 126,851,431	D293A	probably damaging	Het
Eif2a	C	T	3: 58,548,530	R317C	probably damaging	Het
Fancc	A	G	13: 63,330,567	V318A	possibly damaging	Het
Fes	A	T	7: 80,383,986	Y172*	probably null	Het
Gipc3	T	A	10: 81,338,215	I242F	probably damaging	Het
Glul	G	A	1: 153,907,324	M214I	probably benign	Het
Gm14496	A	G	2: 182,001,004	I823V	probably benign	Het
Gm6665	T	C	18: 31,820,265	N50S	probably benign	Het
Gm6729	T	C	10: 86,540,918		noncoding transcript	Het
Gpr21	T	A	2: 37,518,338	C299S	probably damaging	Het
Hapln2	T	A	3: 88,023,377	N196Y	probably benign	Het
Hsd17b12	A	G	2: 94,045,392	V196A	probably benign	Het
Kalrn	A	T	16: 34,392,093	D28E	probably benign	Het
Kcna3	T	C	3: 107,037,935	S505P	possibly damaging	Het
Klra1	A	C	6: 130,372,865	N203K	probably benign	Het
L3mbtl2	T	A	15: 81,675,621	I236N	probably damaging	Het
Mcm3ap	C	A	10: 76,507,361	P1696T	probably damaging	Het
Mecom	T	C	3: 29,957,442	D647G	probably damaging	Het
Mn1	A	G	5: 111,418,746	D194G	probably damaging	Het
Muc5ac	A	G	7: 141,793,689	N407S	probably benign	Het
Mx2	C	T	16: 97,560,351	R584C	probably benign	Het
Myo1c	A	G	11: 75,668,229	R597G	probably benign	Het
Nav3	T	C	10: 109,705,606	D1932G	probably benign	Het
Nwd2	T	A	5: 63,794,242	D205E	probably benign	Het
Olfr1353	T	A	10: 78,970,141	L164*	probably null	Het
Olfr885	T	C	9: 38,061,685	Y122H	probably damaging	Het
Osmr	T	C	15: 6,844,367	E183G	possibly damaging	Het
Peak1	A	T	9: 56,206,687	W627R	probably damaging	Het
Pkd1	C	A	17: 24,595,157	P4167Q	probably damaging	Het
Plekhg4	T	A	8: 105,378,385	L560Q	probably damaging	Het
Prg4	C	T	1: 150,449,999	W1217*	probably null	Het
Prkdc	A	G	16: 15,714,266	I1465V	probably benign	Het
Pus1	A	G	5: 110,777,639	F105S	probably damaging	Het
Ranbp3l	T	C	15: 9,057,125	S154P	probably damaging	Het
Rhbdl1	C	T	17: 25,835,539	G211S	probably damaging	Het
Rnf219	T	C	14: 104,479,186	K584E	probably benign	Het
Rrp36	C	T	17: 46,672,745	R47Q	possibly damaging	Het
Rtp1	T	A	16: 23,431,410	I175N	probably damaging	Het
Sash1	T	A	10: 8,727,908	N1127Y	possibly damaging	Het
Setbp1	C	T	18: 78,858,362	E697K	possibly damaging	Het
Slc27a3	A	T	3: 90,386,317	V587E	probably benign	Het
Slc38a2	A	G	15: 96,691,162	F454L	possibly damaging	Het
Sprn	A	T	7: 140,153,545		probably benign	Het
St14	A	G	9: 31,089,870	V855A	possibly damaging	Het
Syt10	C	T	15: 89,790,776	D456N	probably damaging	Het
Tbc1d1	A	G	5: 64,311,221	E732G	probably damaging	Het
Tnfaip3	A	G	10: 19,003,607	F671S	possibly damaging	Het
Tor1aip2	C	A	1: 156,064,794	P282Q	probably damaging	Het
Ttc7b	C	T	12: 100,415,130		probably null	Het
Ttll2	A	T	17: 7,352,390	F46Y	probably damaging	Het
Ttn	A	G	2: 76,734,150	S28548P	probably damaging	Het
Tubb5	T	C	17: 35,835,298	Y340C	probably benign	Het
Usp32	A	T	11: 85,007,004	C1170*	probably null	Het
Usp54	G	T	14: 20,560,904	H1281Q	probably benign	Het
Vgll4	C	T	6: 114,921,335	G22S	probably benign	Het
Vmn2r120	T	A	17: 57,524,839	I317F	probably benign	Het
Zdhhc5	A	T	2: 84,693,427	F225Y	probably damaging	Het
Zfp652	A	G	11: 95,764,025	E418G	possibly damaging	Het

Other mutations in Kansl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00326:Kansl1	APN	11	104424466	missense	probably damaging	0.96
IGL00658:Kansl1	APN	11	104357526	missense	probably benign	0.10
IGL00688:Kansl1	APN	11	104425066	missense	probably damaging	1.00
IGL01121:Kansl1	APN	11	104335596	missense	probably benign	0.01
IGL01624:Kansl1	APN	11	104424552	missense	probably benign	0.13
IGL02187:Kansl1	APN	11	104378831	splice site	probably null
IGL02711:Kansl1	APN	11	104335575	missense	probably damaging	1.00
IGL02965:Kansl1	APN	11	104335165	missense	probably damaging	0.99
kansas	UTSW	11	104424132	missense	possibly damaging	0.94
wichita	UTSW	11	104356767	missense	possibly damaging	0.90
NA:Kansl1	UTSW	11	104342367	missense	probably benign	0.09
R0399:Kansl1	UTSW	11	104424132	missense	possibly damaging	0.94
R0611:Kansl1	UTSW	11	104338186	missense	probably benign	0.31
R0665:Kansl1	UTSW	11	104343538	missense	probably benign
R0667:Kansl1	UTSW	11	104343538	missense	probably benign
R0747:Kansl1	UTSW	11	104342976	missense	probably benign	0.00
R0865:Kansl1	UTSW	11	104424368	missense	probably benign	0.08
R1479:Kansl1	UTSW	11	104342416	missense	probably damaging	1.00
R1679:Kansl1	UTSW	11	104423996	missense	probably damaging	1.00
R1818:Kansl1	UTSW	11	104342457	missense	possibly damaging	0.80
R1932:Kansl1	UTSW	11	104335097	missense	probably damaging	0.99
R2105:Kansl1	UTSW	11	104335559	missense	probably damaging	0.98
R2907:Kansl1	UTSW	11	104424460	missense	possibly damaging	0.82
R3935:Kansl1	UTSW	11	104343543	missense	possibly damaging	0.83
R3936:Kansl1	UTSW	11	104343543	missense	possibly damaging	0.83
R4282:Kansl1	UTSW	11	104378689	missense	probably benign	0.19
R4455:Kansl1	UTSW	11	104424358	missense	possibly damaging	0.47
R4696:Kansl1	UTSW	11	104356767	missense	possibly damaging	0.90
R4846:Kansl1	UTSW	11	104342972	missense	possibly damaging	0.48
R4890:Kansl1	UTSW	11	104343042	missense	probably benign
R4973:Kansl1	UTSW	11	104424321	missense	probably damaging	1.00
R4975:Kansl1	UTSW	11	104335564	missense	probably damaging	1.00
R5085:Kansl1	UTSW	11	104424342	missense	probably damaging	1.00
R5227:Kansl1	UTSW	11	104356814	missense	probably benign	0.19
R5310:Kansl1	UTSW	11	104424858	missense	possibly damaging	0.95
R5652:Kansl1	UTSW	11	104338166	missense	probably damaging	1.00
R5677:Kansl1	UTSW	11	104335148	missense	probably benign	0.00
R5980:Kansl1	UTSW	11	104343637	missense	possibly damaging	0.96
R6013:Kansl1	UTSW	11	104350639	missense	probably benign	0.00
R6253:Kansl1	UTSW	11	104357526	missense	probably benign	0.10
R7751:Kansl1	UTSW	11	104424064	missense	probably benign	0.30
R7880:Kansl1	UTSW	11	104424153	missense	probably damaging	1.00
R7888:Kansl1	UTSW	11	104342422	missense	probably benign	0.00
R7935:Kansl1	UTSW	11	104424286	missense	probably damaging	0.99
R8251:Kansl1	UTSW	11	104424360	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AGCAATAGTGATTCCAGAGGATTC -3'
(R):5'- TGGCTCTTCCATATGGCAGC -3'

Sequencing Primer
(F):5'- AGGATTCCTCAGTGCCTGGAAAC -3'
(R):5'- GGCAAGTGAGACTACTTGTTAAACC -3'

Posted On

2014-07-14