Incidental Mutation 'R1922:Kansl1'
ID213169
Institutional Source Beutler Lab
Gene Symbol Kansl1
Ensembl Gene ENSMUSG00000018412
Gene NameKAT8 regulatory NSL complex subunit 1
Synonyms1700081L11Rik
MMRRC Submission 039940-MU
Accession Numbers

Genbank: NM_001081045.1; Ensembl: ENSMUST00000018556, ENSMUST00000035872, ENSMUST00000106971, ENSMUST00000106972, ENSMUST00000106974, ENSMUST00000106977, ENSMUST00000134266, ENSMUST00000166536

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1922 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location104333229-104468861 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 104343640 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 680 (L680Q)
Ref Sequence ENSEMBL: ENSMUSP00000102590 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018556] [ENSMUST00000106971] [ENSMUST00000106972] [ENSMUST00000106977]
Predicted Effect probably damaging
Transcript: ENSMUST00000018556
AA Change: L680Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000018556
Gene: ENSMUSG00000018412
AA Change: L680Q

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 164 175 N/A INTRINSIC
low complexity region 245 256 N/A INTRINSIC
coiled coil region 283 311 N/A INTRINSIC
low complexity region 404 417 N/A INTRINSIC
low complexity region 759 772 N/A INTRINSIC
PEHE 816 966 1.53e-53 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000069188
Predicted Effect probably damaging
Transcript: ENSMUST00000106971
AA Change: L680Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102584
Gene: ENSMUSG00000018412
AA Change: L680Q

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 164 175 N/A INTRINSIC
low complexity region 245 256 N/A INTRINSIC
coiled coil region 283 311 N/A INTRINSIC
low complexity region 404 417 N/A INTRINSIC
low complexity region 822 835 N/A INTRINSIC
PEHE 879 1029 1.53e-53 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106972
AA Change: L680Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102585
Gene: ENSMUSG00000018412
AA Change: L680Q

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 164 175 N/A INTRINSIC
low complexity region 245 256 N/A INTRINSIC
coiled coil region 283 311 N/A INTRINSIC
low complexity region 404 417 N/A INTRINSIC
low complexity region 822 835 N/A INTRINSIC
PEHE 879 1029 1.53e-53 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106977
AA Change: L680Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102590
Gene: ENSMUSG00000018412
AA Change: L680Q

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 164 175 N/A INTRINSIC
low complexity region 245 256 N/A INTRINSIC
coiled coil region 283 311 N/A INTRINSIC
low complexity region 404 417 N/A INTRINSIC
low complexity region 759 772 N/A INTRINSIC
PEHE 816 966 1.53e-53 SMART
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.1%
  • 10x: 95.8%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein that is a subunit of two protein complexes involved with histone acetylation, the MLL1 complex and the NSL1 complex. The corresponding protein in Drosophila interacts with K(lysine) acetyltransferase 8, which is also a subunit of both the MLL1 and NSL1 complexes. [provided by RefSeq, Jun 2012]
Allele List at MGI

All alleles(136) : Gene trapped(136)

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A C 6: 48,931,286 I407L probably benign Het
Abca12 G T 1: 71,319,924 N574K probably benign Het
Adcy9 A T 16: 4,311,657 L455H probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Amy1 T A 3: 113,564,895 I163F probably damaging Het
Armc5 A G 7: 128,240,505 S332G probably benign Het
Brd4 T C 17: 32,198,086 probably benign Het
Cadps T C 14: 12,465,859 K1017R possibly damaging Het
Cfap45 A G 1: 172,545,112 E458G probably damaging Het
Chrna1 A G 2: 73,568,232 S288P probably damaging Het
Cpe T A 8: 64,617,689 D174V probably benign Het
Dclre1c T C 2: 3,440,782 F235L possibly damaging Het
Ddx20 A T 3: 105,678,584 V815D probably damaging Het
Dhx9 T C 1: 153,460,274 probably null Het
Dmxl2 A C 9: 54,401,523 H1981Q probably benign Het
Doc2a A C 7: 126,851,431 D293A probably damaging Het
Eif2a C T 3: 58,548,530 R317C probably damaging Het
Fancc A G 13: 63,330,567 V318A possibly damaging Het
Fes A T 7: 80,383,986 Y172* probably null Het
Gipc3 T A 10: 81,338,215 I242F probably damaging Het
Glul G A 1: 153,907,324 M214I probably benign Het
Gm14496 A G 2: 182,001,004 I823V probably benign Het
Gm6665 T C 18: 31,820,265 N50S probably benign Het
Gm6729 T C 10: 86,540,918 noncoding transcript Het
Gpr21 T A 2: 37,518,338 C299S probably damaging Het
Hapln2 T A 3: 88,023,377 N196Y probably benign Het
Hsd17b12 A G 2: 94,045,392 V196A probably benign Het
Kalrn A T 16: 34,392,093 D28E probably benign Het
Kcna3 T C 3: 107,037,935 S505P possibly damaging Het
Klra1 A C 6: 130,372,865 N203K probably benign Het
L3mbtl2 T A 15: 81,675,621 I236N probably damaging Het
Mcm3ap C A 10: 76,507,361 P1696T probably damaging Het
Mecom T C 3: 29,957,442 D647G probably damaging Het
Mn1 A G 5: 111,418,746 D194G probably damaging Het
Muc5ac A G 7: 141,793,689 N407S probably benign Het
Mx2 C T 16: 97,560,351 R584C probably benign Het
Myo1c A G 11: 75,668,229 R597G probably benign Het
Nav3 T C 10: 109,705,606 D1932G probably benign Het
Nwd2 T A 5: 63,794,242 D205E probably benign Het
Olfr1353 T A 10: 78,970,141 L164* probably null Het
Olfr885 T C 9: 38,061,685 Y122H probably damaging Het
Osmr T C 15: 6,844,367 E183G possibly damaging Het
Peak1 A T 9: 56,206,687 W627R probably damaging Het
Pkd1 C A 17: 24,595,157 P4167Q probably damaging Het
Plekhg4 T A 8: 105,378,385 L560Q probably damaging Het
Prg4 C T 1: 150,449,999 W1217* probably null Het
Prkdc A G 16: 15,714,266 I1465V probably benign Het
Pus1 A G 5: 110,777,639 F105S probably damaging Het
Ranbp3l T C 15: 9,057,125 S154P probably damaging Het
Rhbdl1 C T 17: 25,835,539 G211S probably damaging Het
Rnf219 T C 14: 104,479,186 K584E probably benign Het
Rrp36 C T 17: 46,672,745 R47Q possibly damaging Het
Rtp1 T A 16: 23,431,410 I175N probably damaging Het
Sash1 T A 10: 8,727,908 N1127Y possibly damaging Het
Setbp1 C T 18: 78,858,362 E697K possibly damaging Het
Slc27a3 A T 3: 90,386,317 V587E probably benign Het
Slc38a2 A G 15: 96,691,162 F454L possibly damaging Het
Sprn A T 7: 140,153,545 probably benign Het
St14 A G 9: 31,089,870 V855A possibly damaging Het
Syt10 C T 15: 89,790,776 D456N probably damaging Het
Tbc1d1 A G 5: 64,311,221 E732G probably damaging Het
Tnfaip3 A G 10: 19,003,607 F671S possibly damaging Het
Tor1aip2 C A 1: 156,064,794 P282Q probably damaging Het
Ttc7b C T 12: 100,415,130 probably null Het
Ttll2 A T 17: 7,352,390 F46Y probably damaging Het
Ttn A G 2: 76,734,150 S28548P probably damaging Het
Tubb5 T C 17: 35,835,298 Y340C probably benign Het
Usp32 A T 11: 85,007,004 C1170* probably null Het
Usp54 G T 14: 20,560,904 H1281Q probably benign Het
Vgll4 C T 6: 114,921,335 G22S probably benign Het
Vmn2r120 T A 17: 57,524,839 I317F probably benign Het
Zdhhc5 A T 2: 84,693,427 F225Y probably damaging Het
Zfp652 A G 11: 95,764,025 E418G possibly damaging Het
Other mutations in Kansl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Kansl1 APN 11 104424466 missense probably damaging 0.96
IGL00658:Kansl1 APN 11 104357526 missense probably benign 0.10
IGL00688:Kansl1 APN 11 104425066 missense probably damaging 1.00
IGL01121:Kansl1 APN 11 104335596 missense probably benign 0.01
IGL01624:Kansl1 APN 11 104424552 missense probably benign 0.13
IGL02187:Kansl1 APN 11 104378831 splice site probably null
IGL02711:Kansl1 APN 11 104335575 missense probably damaging 1.00
IGL02965:Kansl1 APN 11 104335165 missense probably damaging 0.99
kansas UTSW 11 104424132 missense possibly damaging 0.94
wichita UTSW 11 104356767 missense possibly damaging 0.90
NA:Kansl1 UTSW 11 104342367 missense probably benign 0.09
R0399:Kansl1 UTSW 11 104424132 missense possibly damaging 0.94
R0611:Kansl1 UTSW 11 104338186 missense probably benign 0.31
R0665:Kansl1 UTSW 11 104343538 missense probably benign
R0667:Kansl1 UTSW 11 104343538 missense probably benign
R0747:Kansl1 UTSW 11 104342976 missense probably benign 0.00
R0865:Kansl1 UTSW 11 104424368 missense probably benign 0.08
R1479:Kansl1 UTSW 11 104342416 missense probably damaging 1.00
R1679:Kansl1 UTSW 11 104423996 missense probably damaging 1.00
R1818:Kansl1 UTSW 11 104342457 missense possibly damaging 0.80
R1932:Kansl1 UTSW 11 104335097 missense probably damaging 0.99
R2105:Kansl1 UTSW 11 104335559 missense probably damaging 0.98
R2907:Kansl1 UTSW 11 104424460 missense possibly damaging 0.82
R3935:Kansl1 UTSW 11 104343543 missense possibly damaging 0.83
R3936:Kansl1 UTSW 11 104343543 missense possibly damaging 0.83
R4282:Kansl1 UTSW 11 104378689 missense probably benign 0.19
R4455:Kansl1 UTSW 11 104424358 missense possibly damaging 0.47
R4696:Kansl1 UTSW 11 104356767 missense possibly damaging 0.90
R4846:Kansl1 UTSW 11 104342972 missense possibly damaging 0.48
R4890:Kansl1 UTSW 11 104343042 missense probably benign
R4973:Kansl1 UTSW 11 104424321 missense probably damaging 1.00
R4975:Kansl1 UTSW 11 104335564 missense probably damaging 1.00
R5085:Kansl1 UTSW 11 104424342 missense probably damaging 1.00
R5227:Kansl1 UTSW 11 104356814 missense probably benign 0.19
R5310:Kansl1 UTSW 11 104424858 missense possibly damaging 0.95
R5652:Kansl1 UTSW 11 104338166 missense probably damaging 1.00
R5677:Kansl1 UTSW 11 104335148 missense probably benign 0.00
R5980:Kansl1 UTSW 11 104343637 missense possibly damaging 0.96
R6013:Kansl1 UTSW 11 104350639 missense probably benign 0.00
R6253:Kansl1 UTSW 11 104357526 missense probably benign 0.10
R7751:Kansl1 UTSW 11 104424064 missense probably benign 0.30
R7880:Kansl1 UTSW 11 104424153 missense probably damaging 1.00
R7888:Kansl1 UTSW 11 104342422 missense probably benign 0.00
R7963:Kansl1 UTSW 11 104424153 missense probably damaging 1.00
R7971:Kansl1 UTSW 11 104342422 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCAATAGTGATTCCAGAGGATTC -3'
(R):5'- TGGCTCTTCCATATGGCAGC -3'

Sequencing Primer
(F):5'- AGGATTCCTCAGTGCCTGGAAAC -3'
(R):5'- GGCAAGTGAGACTACTTGTTAAACC -3'
Posted On2014-07-14