Mutagenetix > Incidental Mutation

Incidental Mutation 'R1922:Cadps'

213172

Institutional Source

Beutler Lab

Gene Symbol

Cadps

Ensembl Gene

ENSMUSG00000054423

Gene Name

Ca2+-dependent secretion activator

Synonyms

CAPS1

MMRRC Submission

039940-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1922 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

12372563-12823079 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 12465859 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Arginine at position 1017 (K1017R)

Ref Sequence

ENSEMBL: ENSMUSP00000064706 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067491] [ENSMUST00000112657] [ENSMUST00000112658] [ENSMUST00000177814] [ENSMUST00000224882]

AlphaFold

Q80TJ1

Predicted Effect

possibly damaging
Transcript: ENSMUST00000067491
AA Change: K1017R

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000064706
Gene: ENSMUSG00000054423
AA Change: K1017R

Domain	Start	End	E-Value	Type
low complexity region	5	18	N/A	INTRINSIC
low complexity region	41	75	N/A	INTRINSIC
coiled coil region	93	121	N/A	INTRINSIC
C2	397	492	1.08e-2	SMART
PH	520	624	1.78e-10	SMART
low complexity region	772	783	N/A	INTRINSIC
DUF1041	833	948	6.21e-54	SMART
low complexity region	1022	1045	N/A	INTRINSIC
low complexity region	1354	1361	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000112657
AA Change: K1010R

PolyPhen 2 Score 0.285 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000108276
Gene: ENSMUSG00000054423
AA Change: K1010R

Domain	Start	End	E-Value	Type
low complexity region	5	18	N/A	INTRINSIC
low complexity region	41	75	N/A	INTRINSIC
coiled coil region	93	121	N/A	INTRINSIC
C2	397	492	1.08e-2	SMART
PH	520	624	1.78e-10	SMART
low complexity region	775	786	N/A	INTRINSIC
DUF1041	836	941	3.88e-55	SMART
low complexity region	1015	1038	N/A	INTRINSIC
low complexity region	1347	1354	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000112658
AA Change: K1011R

PolyPhen 2 Score 0.285 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000108277
Gene: ENSMUSG00000054423
AA Change: K1011R

Domain	Start	End	E-Value	Type
low complexity region	5	18	N/A	INTRINSIC
low complexity region	41	75	N/A	INTRINSIC
coiled coil region	93	121	N/A	INTRINSIC
C2	397	492	1.08e-2	SMART
PH	520	624	1.78e-10	SMART
low complexity region	776	787	N/A	INTRINSIC
DUF1041	837	942	3.88e-55	SMART
low complexity region	1016	1039	N/A	INTRINSIC
low complexity region	1348	1355	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000177814
AA Change: K1012R

PolyPhen 2 Score 0.285 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000136076
Gene: ENSMUSG00000054423
AA Change: K1012R

Domain	Start	End	E-Value	Type
low complexity region	5	18	N/A	INTRINSIC
low complexity region	41	75	N/A	INTRINSIC
coiled coil region	93	121	N/A	INTRINSIC
C2	397	492	1.08e-2	SMART
PH	520	624	1.78e-10	SMART
low complexity region	777	788	N/A	INTRINSIC
DUF1041	838	943	2.75e-55	SMART
low complexity region	1017	1040	N/A	INTRINSIC
low complexity region	1349	1356	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224106

Predicted Effect

unknown
Transcript: ENSMUST00000224581
AA Change: N190S

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224704

Predicted Effect

probably benign
Transcript: ENSMUST00000224882

Meta Mutation Damage Score

0.0601

Coding Region Coverage

1x: 97.5%
3x: 97.1%
10x: 95.8%
20x: 93.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a novel neural/endocrine-specific cytosolic and peripheral membrane protein required for the Ca2+-regulated exocytosis of secretory vesicles. The protein acts at a stage in exocytosis that follows ATP-dependent priming, which involves the essential synthesis of phosphatidylinositol 4,5-bisphosphate (PtdIns(4,5)P2). Alternative splicing has been observed at this locus and three variants, encoding distinct isoforms, are described. [provided by RefSeq, Aug 2008]
PHENOTYPE: Homozygous null mice display neonatal lethality, respiratory failure and abnormal adrenal gland physiology. Adult heterozygous null mice display abnormal adrenal gland physiology that is different from that seen in homozygous neonates. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600015I10Rik	A	C	6: 48,931,286	I407L	probably benign	Het
Abca12	G	T	1: 71,319,924	N574K	probably benign	Het
Adcy9	A	T	16: 4,311,657	L455H	probably damaging	Het
Alkbh2	C	T	5: 114,124,226	E148K	probably damaging	Het
Amy1	T	A	3: 113,564,895	I163F	probably damaging	Het
Armc5	A	G	7: 128,240,505	S332G	probably benign	Het
Brd4	T	C	17: 32,198,086		probably benign	Het
Cfap45	A	G	1: 172,545,112	E458G	probably damaging	Het
Chrna1	A	G	2: 73,568,232	S288P	probably damaging	Het
Cpe	T	A	8: 64,617,689	D174V	probably benign	Het
Dclre1c	T	C	2: 3,440,782	F235L	possibly damaging	Het
Ddx20	A	T	3: 105,678,584	V815D	probably damaging	Het
Dhx9	T	C	1: 153,460,274		probably null	Het
Dmxl2	A	C	9: 54,401,523	H1981Q	probably benign	Het
Doc2a	A	C	7: 126,851,431	D293A	probably damaging	Het
Eif2a	C	T	3: 58,548,530	R317C	probably damaging	Het
Fancc	A	G	13: 63,330,567	V318A	possibly damaging	Het
Fes	A	T	7: 80,383,986	Y172*	probably null	Het
Gipc3	T	A	10: 81,338,215	I242F	probably damaging	Het
Glul	G	A	1: 153,907,324	M214I	probably benign	Het
Gm14496	A	G	2: 182,001,004	I823V	probably benign	Het
Gm6665	T	C	18: 31,820,265	N50S	probably benign	Het
Gm6729	T	C	10: 86,540,918		noncoding transcript	Het
Gpr21	T	A	2: 37,518,338	C299S	probably damaging	Het
Hapln2	T	A	3: 88,023,377	N196Y	probably benign	Het
Hsd17b12	A	G	2: 94,045,392	V196A	probably benign	Het
Kalrn	A	T	16: 34,392,093	D28E	probably benign	Het
Kansl1	A	T	11: 104,343,640	L680Q	probably damaging	Het
Kcna3	T	C	3: 107,037,935	S505P	possibly damaging	Het
Klra1	A	C	6: 130,372,865	N203K	probably benign	Het
L3mbtl2	T	A	15: 81,675,621	I236N	probably damaging	Het
Mcm3ap	C	A	10: 76,507,361	P1696T	probably damaging	Het
Mecom	T	C	3: 29,957,442	D647G	probably damaging	Het
Mn1	A	G	5: 111,418,746	D194G	probably damaging	Het
Muc5ac	A	G	7: 141,793,689	N407S	probably benign	Het
Mx2	C	T	16: 97,560,351	R584C	probably benign	Het
Myo1c	A	G	11: 75,668,229	R597G	probably benign	Het
Nav3	T	C	10: 109,705,606	D1932G	probably benign	Het
Nwd2	T	A	5: 63,794,242	D205E	probably benign	Het
Olfr1353	T	A	10: 78,970,141	L164*	probably null	Het
Olfr885	T	C	9: 38,061,685	Y122H	probably damaging	Het
Osmr	T	C	15: 6,844,367	E183G	possibly damaging	Het
Peak1	A	T	9: 56,206,687	W627R	probably damaging	Het
Pkd1	C	A	17: 24,595,157	P4167Q	probably damaging	Het
Plekhg4	T	A	8: 105,378,385	L560Q	probably damaging	Het
Prg4	C	T	1: 150,449,999	W1217*	probably null	Het
Prkdc	A	G	16: 15,714,266	I1465V	probably benign	Het
Pus1	A	G	5: 110,777,639	F105S	probably damaging	Het
Ranbp3l	T	C	15: 9,057,125	S154P	probably damaging	Het
Rhbdl1	C	T	17: 25,835,539	G211S	probably damaging	Het
Rnf219	T	C	14: 104,479,186	K584E	probably benign	Het
Rrp36	C	T	17: 46,672,745	R47Q	possibly damaging	Het
Rtp1	T	A	16: 23,431,410	I175N	probably damaging	Het
Sash1	T	A	10: 8,727,908	N1127Y	possibly damaging	Het
Setbp1	C	T	18: 78,858,362	E697K	possibly damaging	Het
Slc27a3	A	T	3: 90,386,317	V587E	probably benign	Het
Slc38a2	A	G	15: 96,691,162	F454L	possibly damaging	Het
Sprn	A	T	7: 140,153,545		probably benign	Het
St14	A	G	9: 31,089,870	V855A	possibly damaging	Het
Syt10	C	T	15: 89,790,776	D456N	probably damaging	Het
Tbc1d1	A	G	5: 64,311,221	E732G	probably damaging	Het
Tnfaip3	A	G	10: 19,003,607	F671S	possibly damaging	Het
Tor1aip2	C	A	1: 156,064,794	P282Q	probably damaging	Het
Ttc7b	C	T	12: 100,415,130		probably null	Het
Ttll2	A	T	17: 7,352,390	F46Y	probably damaging	Het
Ttn	A	G	2: 76,734,150	S28548P	probably damaging	Het
Tubb5	T	C	17: 35,835,298	Y340C	probably benign	Het
Usp32	A	T	11: 85,007,004	C1170*	probably null	Het
Usp54	G	T	14: 20,560,904	H1281Q	probably benign	Het
Vgll4	C	T	6: 114,921,335	G22S	probably benign	Het
Vmn2r120	T	A	17: 57,524,839	I317F	probably benign	Het
Zdhhc5	A	T	2: 84,693,427	F225Y	probably damaging	Het
Zfp652	A	G	11: 95,764,025	E418G	possibly damaging	Het

Other mutations in Cadps

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00926:Cadps	APN	14	12491795	missense	probably damaging	1.00
IGL00990:Cadps	APN	14	12715374	missense	possibly damaging	0.56
IGL01071:Cadps	APN	14	12509091	splice site	probably null
IGL01339:Cadps	APN	14	12486543	missense	possibly damaging	0.58
IGL01518:Cadps	APN	14	12522352	missense	probably damaging	1.00
IGL01560:Cadps	APN	14	12491792	missense	probably damaging	1.00
IGL01598:Cadps	APN	14	12522202	critical splice donor site	probably null
IGL01603:Cadps	APN	14	12454154	splice site	probably benign
IGL01836:Cadps	APN	14	12522311	missense	probably damaging	1.00
IGL01839:Cadps	APN	14	12467184	splice site	probably benign
IGL01932:Cadps	APN	14	12373609	utr 3 prime	probably benign
IGL02172:Cadps	APN	14	12705681	missense	probably damaging	1.00
IGL02175:Cadps	APN	14	12467092	missense	probably damaging	0.96
IGL02212:Cadps	APN	14	12522345	missense	possibly damaging	0.94
IGL02351:Cadps	APN	14	12597380	missense	probably damaging	0.99
IGL02358:Cadps	APN	14	12597380	missense	probably damaging	0.99
IGL02499:Cadps	APN	14	12822725	nonsense	probably null
IGL02505:Cadps	APN	14	12449759	missense	probably damaging	1.00
IGL02591:Cadps	APN	14	12473465	missense	probably damaging	1.00
IGL02592:Cadps	APN	14	12473465	missense	probably damaging	1.00
IGL02671:Cadps	APN	14	12491824	missense	probably damaging	1.00
IGL02956:Cadps	APN	14	12418047	splice site	probably benign
IGL03029:Cadps	APN	14	12376675	missense	probably damaging	1.00
IGL03216:Cadps	APN	14	12439944	missense	probably damaging	1.00
IGL03282:Cadps	APN	14	12465856	splice site	probably benign
turbo	UTSW	14	12491800	missense	probably damaging	1.00
R0241:Cadps	UTSW	14	12376675	missense	probably damaging	1.00
R0241:Cadps	UTSW	14	12376675	missense	probably damaging	1.00
R0420:Cadps	UTSW	14	12491800	missense	probably damaging	1.00
R1180:Cadps	UTSW	14	12457836	splice site	probably benign
R1398:Cadps	UTSW	14	12449822	missense	probably damaging	1.00
R1678:Cadps	UTSW	14	12517802	critical splice donor site	probably null
R1792:Cadps	UTSW	14	12449802	missense	possibly damaging	0.93
R1863:Cadps	UTSW	14	12449802	missense	possibly damaging	0.93
R1863:Cadps	UTSW	14	12505796	missense	probably benign	0.09
R1918:Cadps	UTSW	14	12546372	missense	probably damaging	0.99
R1920:Cadps	UTSW	14	12465859	missense	possibly damaging	0.64
R1921:Cadps	UTSW	14	12465859	missense	possibly damaging	0.64
R1925:Cadps	UTSW	14	12705726	missense	probably damaging	1.00
R1966:Cadps	UTSW	14	12822450	nonsense	probably null
R2013:Cadps	UTSW	14	12522337	missense	probably damaging	1.00
R2228:Cadps	UTSW	14	12465935	missense	probably benign	0.05
R2331:Cadps	UTSW	14	12603692	missense	probably damaging	1.00
R3436:Cadps	UTSW	14	12616158	splice site	probably null
R3853:Cadps	UTSW	14	12509090	splice site	probably benign
R3893:Cadps	UTSW	14	12488883	utr 3 prime	probably benign
R3916:Cadps	UTSW	14	12457702	missense	probably benign	0.00
R3917:Cadps	UTSW	14	12457702	missense	probably benign	0.00
R3953:Cadps	UTSW	14	12505937	missense	probably damaging	1.00
R3966:Cadps	UTSW	14	12522161	splice site	probably null
R4024:Cadps	UTSW	14	12705539	missense	probably damaging	1.00
R4079:Cadps	UTSW	14	12457702	missense	probably benign	0.00
R4230:Cadps	UTSW	14	12488987	missense	probably damaging	0.98
R4333:Cadps	UTSW	14	12467031	missense	probably damaging	1.00
R4410:Cadps	UTSW	14	12822323	missense	probably damaging	0.98
R4586:Cadps	UTSW	14	12505808	missense	probably damaging	1.00
R4685:Cadps	UTSW	14	12467139	missense	possibly damaging	0.77
R4698:Cadps	UTSW	14	12705654	missense	possibly damaging	0.90
R4855:Cadps	UTSW	14	12822449	missense	unknown
R4898:Cadps	UTSW	14	12411588	missense	possibly damaging	0.86
R4908:Cadps	UTSW	14	12536386	missense	probably damaging	1.00
R5208:Cadps	UTSW	14	12457711	missense	possibly damaging	0.68
R5297:Cadps	UTSW	14	12822345	missense	probably damaging	1.00
R5328:Cadps	UTSW	14	12457790	missense	probably benign	0.31
R5408:Cadps	UTSW	14	12705759	missense	possibly damaging	0.87
R5529:Cadps	UTSW	14	12454285	missense	probably damaging	1.00
R5567:Cadps	UTSW	14	12473497	missense	possibly damaging	0.49
R5570:Cadps	UTSW	14	12473497	missense	possibly damaging	0.49
R5727:Cadps	UTSW	14	12486525	nonsense	probably null
R5812:Cadps	UTSW	14	12376685	missense	probably benign
R6361:Cadps	UTSW	14	12491778	nonsense	probably null
R6767:Cadps	UTSW	14	12550888	missense	probably damaging	1.00
R6805:Cadps	UTSW	14	12467103	missense	probably damaging	0.99
R6861:Cadps	UTSW	14	12522401	nonsense	probably null
R6883:Cadps	UTSW	14	12465883	missense	probably damaging	0.96
R6887:Cadps	UTSW	14	12505811	missense	probably damaging	1.00
R6997:Cadps	UTSW	14	12505793	missense	possibly damaging	0.88
R7102:Cadps	UTSW	14	12603738	missense	probably damaging	1.00
R7120:Cadps	UTSW	14	12439919	missense	probably damaging	0.98
R7143:Cadps	UTSW	14	12491838	missense	probably benign	0.02
R7290:Cadps	UTSW	14	12616099	missense	probably damaging	1.00
R7614:Cadps	UTSW	14	12454260	missense	probably damaging	1.00
R7674:Cadps	UTSW	14	12411581	missense	probably damaging	0.99
R7715:Cadps	UTSW	14	12457762	missense	probably benign	0.01
R7801:Cadps	UTSW	14	12489476	critical splice donor site	probably null
R7814:Cadps	UTSW	14	12376706	missense	probably damaging	0.99
R7915:Cadps	UTSW	14	12705544	missense	possibly damaging	0.84
R8087:Cadps	UTSW	14	12536380	missense	probably damaging	1.00
R8109:Cadps	UTSW	14	12488975	missense	probably benign	0.00
R8485:Cadps	UTSW	14	12439872	missense	probably damaging	1.00
R9156:Cadps	UTSW	14	12705676	missense	probably damaging	1.00
R9158:Cadps	UTSW	14	12546356	missense	probably benign	0.10
R9312:Cadps	UTSW	14	12616095	missense	probably damaging	1.00
R9465:Cadps	UTSW	14	12489002	missense	possibly damaging	0.93
R9519:Cadps	UTSW	14	12546290	missense	possibly damaging	0.86
R9649:Cadps	UTSW	14	12597418	missense	probably damaging	0.99
R9662:Cadps	UTSW	14	12411567	missense	probably benign	0.02
R9674:Cadps	UTSW	14	12454291	missense	probably damaging	1.00
X0018:Cadps	UTSW	14	12373690	missense	probably damaging	1.00
X0028:Cadps	UTSW	14	12467118	missense	possibly damaging	0.93
Z1088:Cadps	UTSW	14	12467113	missense	probably damaging	0.96
Z1177:Cadps	UTSW	14	12465880	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CACCCATGGTTACATCTCTCAG -3'
(R):5'- AATTGCTCTGGGTTCTGACG -3'

Sequencing Primer
(F):5'- ATGGTTACATCTCTCAGTCCTCTG -3'
(R):5'- CTGACGGAGATTTTGCTTATCTG -3'

Posted On

2014-07-14