Incidental Mutation 'R1922:Slc38a2'
ID213180
Institutional Source Beutler Lab
Gene Symbol Slc38a2
Ensembl Gene ENSMUSG00000022462
Gene Namesolute carrier family 38, member 2
Synonyms5033402L14Rik
MMRRC Submission 039940-MU
Accession Numbers

NCBI RefSeq: NM_175121.3; MGI:1915010

Is this an essential gene? Possibly non essential (E-score: 0.348) question?
Stock #R1922 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location96687392-96699730 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 96691162 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 454 (F454L)
Ref Sequence ENSEMBL: ENSMUSP00000023099 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023099]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023099
AA Change: F454L

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000023099
Gene: ENSMUSG00000022462
AA Change: F454L

DomainStartEndE-ValueType
low complexity region 10 30 N/A INTRINSIC
Pfam:Aa_trans 69 492 2e-76 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229141
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.1%
  • 10x: 95.8%
  • 20x: 93.7%
Validation Efficiency
Allele List at MGI

All alleles(18) : Targeted(2) Gene trapped(16)

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A C 6: 48,931,286 I407L probably benign Het
Abca12 G T 1: 71,319,924 N574K probably benign Het
Adcy9 A T 16: 4,311,657 L455H probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Amy1 T A 3: 113,564,895 I163F probably damaging Het
Armc5 A G 7: 128,240,505 S332G probably benign Het
Brd4 T C 17: 32,198,086 probably benign Het
Cadps T C 14: 12,465,859 K1017R possibly damaging Het
Cfap45 A G 1: 172,545,112 E458G probably damaging Het
Chrna1 A G 2: 73,568,232 S288P probably damaging Het
Cpe T A 8: 64,617,689 D174V probably benign Het
Dclre1c T C 2: 3,440,782 F235L possibly damaging Het
Ddx20 A T 3: 105,678,584 V815D probably damaging Het
Dhx9 T C 1: 153,460,274 probably null Het
Dmxl2 A C 9: 54,401,523 H1981Q probably benign Het
Doc2a A C 7: 126,851,431 D293A probably damaging Het
Eif2a C T 3: 58,548,530 R317C probably damaging Het
Fancc A G 13: 63,330,567 V318A possibly damaging Het
Fes A T 7: 80,383,986 Y172* probably null Het
Gipc3 T A 10: 81,338,215 I242F probably damaging Het
Glul G A 1: 153,907,324 M214I probably benign Het
Gm14496 A G 2: 182,001,004 I823V probably benign Het
Gm6665 T C 18: 31,820,265 N50S probably benign Het
Gm6729 T C 10: 86,540,918 noncoding transcript Het
Gpr21 T A 2: 37,518,338 C299S probably damaging Het
Hapln2 T A 3: 88,023,377 N196Y probably benign Het
Hsd17b12 A G 2: 94,045,392 V196A probably benign Het
Kalrn A T 16: 34,392,093 D28E probably benign Het
Kansl1 A T 11: 104,343,640 L680Q probably damaging Het
Kcna3 T C 3: 107,037,935 S505P possibly damaging Het
Klra1 A C 6: 130,372,865 N203K probably benign Het
L3mbtl2 T A 15: 81,675,621 I236N probably damaging Het
Mcm3ap C A 10: 76,507,361 P1696T probably damaging Het
Mecom T C 3: 29,957,442 D647G probably damaging Het
Mn1 A G 5: 111,418,746 D194G probably damaging Het
Muc5ac A G 7: 141,793,689 N407S probably benign Het
Mx2 C T 16: 97,560,351 R584C probably benign Het
Myo1c A G 11: 75,668,229 R597G probably benign Het
Nav3 T C 10: 109,705,606 D1932G probably benign Het
Nwd2 T A 5: 63,794,242 D205E probably benign Het
Olfr1353 T A 10: 78,970,141 L164* probably null Het
Olfr885 T C 9: 38,061,685 Y122H probably damaging Het
Osmr T C 15: 6,844,367 E183G possibly damaging Het
Peak1 A T 9: 56,206,687 W627R probably damaging Het
Pkd1 C A 17: 24,595,157 P4167Q probably damaging Het
Plekhg4 T A 8: 105,378,385 L560Q probably damaging Het
Prg4 C T 1: 150,449,999 W1217* probably null Het
Prkdc A G 16: 15,714,266 I1465V probably benign Het
Pus1 A G 5: 110,777,639 F105S probably damaging Het
Ranbp3l T C 15: 9,057,125 S154P probably damaging Het
Rhbdl1 C T 17: 25,835,539 G211S probably damaging Het
Rnf219 T C 14: 104,479,186 K584E probably benign Het
Rrp36 C T 17: 46,672,745 R47Q possibly damaging Het
Rtp1 T A 16: 23,431,410 I175N probably damaging Het
Sash1 T A 10: 8,727,908 N1127Y possibly damaging Het
Setbp1 C T 18: 78,858,362 E697K possibly damaging Het
Slc27a3 A T 3: 90,386,317 V587E probably benign Het
Sprn A T 7: 140,153,545 probably benign Het
St14 A G 9: 31,089,870 V855A possibly damaging Het
Syt10 C T 15: 89,790,776 D456N probably damaging Het
Tbc1d1 A G 5: 64,311,221 E732G probably damaging Het
Tnfaip3 A G 10: 19,003,607 F671S possibly damaging Het
Tor1aip2 C A 1: 156,064,794 P282Q probably damaging Het
Ttc7b C T 12: 100,415,130 probably null Het
Ttll2 A T 17: 7,352,390 F46Y probably damaging Het
Ttn A G 2: 76,734,150 S28548P probably damaging Het
Tubb5 T C 17: 35,835,298 Y340C probably benign Het
Usp32 A T 11: 85,007,004 C1170* probably null Het
Usp54 G T 14: 20,560,904 H1281Q probably benign Het
Vgll4 C T 6: 114,921,335 G22S probably benign Het
Vmn2r120 T A 17: 57,524,839 I317F probably benign Het
Zdhhc5 A T 2: 84,693,427 F225Y probably damaging Het
Zfp652 A G 11: 95,764,025 E418G possibly damaging Het
Other mutations in Slc38a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01116:Slc38a2 APN 15 96693185 splice site probably benign
IGL01522:Slc38a2 APN 15 96693055 missense possibly damaging 0.78
IGL01679:Slc38a2 APN 15 96697954 nonsense probably null
IGL01720:Slc38a2 APN 15 96691211 splice site probably benign
IGL02198:Slc38a2 APN 15 96692377 missense probably damaging 0.99
IGL02685:Slc38a2 APN 15 96691425 missense probably benign 0.00
IGL03211:Slc38a2 APN 15 96698272 splice site probably null
P0014:Slc38a2 UTSW 15 96690161 missense probably damaging 0.96
R0068:Slc38a2 UTSW 15 96691292 splice site probably null
R0068:Slc38a2 UTSW 15 96691292 splice site probably null
R0684:Slc38a2 UTSW 15 96695287 nonsense probably null
R1537:Slc38a2 UTSW 15 96693153 missense possibly damaging 0.50
R1638:Slc38a2 UTSW 15 96692536 missense probably damaging 1.00
R2294:Slc38a2 UTSW 15 96691762 missense probably benign
R4672:Slc38a2 UTSW 15 96698637 missense probably benign 0.00
R5799:Slc38a2 UTSW 15 96695089 missense probably benign 0.29
R5878:Slc38a2 UTSW 15 96692584 missense probably damaging 0.96
R6188:Slc38a2 UTSW 15 96692516 critical splice donor site probably null
R7097:Slc38a2 UTSW 15 96693301 missense probably damaging 0.98
R7122:Slc38a2 UTSW 15 96693301 missense probably damaging 0.98
R7130:Slc38a2 UTSW 15 96691382 missense probably damaging 1.00
R7224:Slc38a2 UTSW 15 96691359 missense probably damaging 1.00
R7776:Slc38a2 UTSW 15 96690152 missense probably benign 0.04
R7896:Slc38a2 UTSW 15 96693585 missense probably damaging 1.00
R7964:Slc38a2 UTSW 15 96692572 missense probably benign 0.29
R8427:Slc38a2 UTSW 15 96692413 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACGTCAGTACTTTCGCACTG -3'
(R):5'- ATCATCACCGTGACCATCTTG -3'

Sequencing Primer
(F):5'- ACTGTTCTTTAATATCTTCCTTGCAG -3'
(R):5'- GACCATCTTGTCCTTCACCAATTTG -3'
Posted On2014-07-14