Incidental Mutation 'R1923:Fmn1'
ID213202
Institutional Source Beutler Lab
Gene Symbol Fmn1
Ensembl Gene ENSMUSG00000044042
Gene Nameformin 1
SynonymsFmn, formin-1
MMRRC Submission 039941-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.282) question?
Stock #R1923 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location113327736-113716767 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 113429721 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125052 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099576] [ENSMUST00000102547] [ENSMUST00000161731]
Predicted Effect unknown
Transcript: ENSMUST00000099576
AA Change: V653A
SMART Domains Protein: ENSMUSP00000097171
Gene: ENSMUSG00000044042
AA Change: V653A

DomainStartEndE-ValueType
low complexity region 159 173 N/A INTRINSIC
Blast:FH2 352 861 N/A BLAST
SCOP:d1jvr__ 894 925 2e-3 SMART
FH2 983 1388 1.16e-137 SMART
Predicted Effect unknown
Transcript: ENSMUST00000102547
AA Change: V653A
SMART Domains Protein: ENSMUSP00000099606
Gene: ENSMUSG00000044042
AA Change: V653A

DomainStartEndE-ValueType
low complexity region 159 173 N/A INTRINSIC
Blast:FH2 352 861 N/A BLAST
SCOP:d1jvr__ 894 925 2e-3 SMART
FH2 983 1424 1.03e-134 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000110954
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143525
Predicted Effect probably benign
Transcript: ENSMUST00000161731
SMART Domains Protein: ENSMUSP00000125052
Gene: ENSMUSG00000044042

DomainStartEndE-ValueType
low complexity region 159 173 N/A INTRINSIC
Blast:FH2 352 619 1e-62 BLAST
Blast:FH2 625 765 3e-53 BLAST
SCOP:d1jvr__ 796 827 2e-3 SMART
FH2 885 1290 1.16e-137 SMART
Meta Mutation Damage Score 0.0693 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.5%
  • 20x: 92.9%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the formin homology family and encodes a protein that has a role in the formation of adherens junction and the polymerization of linear actin cables. The homologous gene in mouse is associated with limb deformity. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for spontaneous, irradiation-induced, and transgene-insertional mutations show severe syndactyly and oligodactyly of the feet, abnormal long bones (including radius-ulna fusions), and reduced or absent kidneys. Many mutants survive and breed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik A T 18: 57,533,887 D12V probably damaging Het
2610008E11Rik T C 10: 79,067,909 E163G probably damaging Het
4921513D11Rik A G 17: 79,628,133 probably benign Het
Acox3 T A 5: 35,592,115 F195I possibly damaging Het
Acsl6 T C 11: 54,325,591 Y135H probably damaging Het
Ankhd1 C A 18: 36,648,030 A2045E probably benign Het
Ap5z1 A G 5: 142,472,341 H423R probably benign Het
Arsk T A 13: 76,066,866 probably benign Het
Bpi G A 2: 158,261,163 G76D probably damaging Het
Carmil3 A G 14: 55,502,404 T983A probably damaging Het
Chmp2b A T 16: 65,545,327 M125K possibly damaging Het
Clca3a2 T A 3: 144,805,730 I26L probably damaging Het
Cubn T C 2: 13,310,526 Y3032C probably damaging Het
Ehbp1 T A 11: 22,151,850 D226V probably damaging Het
Enpp6 A T 8: 47,082,506 D362V probably damaging Het
Fam53b A G 7: 132,715,792 S374P probably damaging Het
Fndc7 C T 3: 108,876,687 R202H probably benign Het
Frmd4b T G 6: 97,288,454 D951A probably benign Het
Git2 A G 5: 114,739,101 Y107H probably damaging Het
Gm11595 A T 11: 99,772,539 V105E unknown Het
Krt26 CTAGTA CTA 11: 99,333,526 probably benign Het
Lrriq4 C A 3: 30,659,093 Q448K probably benign Het
Ly6g5c A G 17: 35,111,887 I128M possibly damaging Het
Mroh9 T A 1: 163,076,291 S51C probably damaging Het
Myh3 A G 11: 67,080,002 S2G probably benign Het
Nat8f4 A G 6: 85,901,515 Y9H probably damaging Het
Negr1 T C 3: 156,562,199 V2A probably benign Het
Olfr1079 T G 2: 86,538,513 Y132S probably damaging Het
Olfr1385 C T 11: 49,495,304 T257I probably damaging Het
Olfr832 C T 9: 18,945,485 T279I probably benign Het
Otog G A 7: 46,246,283 C107Y probably damaging Het
Pdgfra C A 5: 75,163,733 T83K probably benign Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Retreg1 A G 15: 25,969,838 D109G probably damaging Het
Rgs12 T A 5: 35,032,269 W674R probably damaging Het
Rgs18 T C 1: 144,756,080 D98G possibly damaging Het
Rnf146 A G 10: 29,347,719 F57S probably damaging Het
Slc22a20 C A 19: 5,971,436 V513L probably benign Het
Stox2 G T 8: 47,193,626 F266L probably damaging Het
Tbx21 C T 11: 97,100,037 V272M probably damaging Het
Tmc7 A G 7: 118,545,627 F570S probably benign Het
Tmem236 T C 2: 14,219,306 I302T probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trpm3 T C 19: 22,885,412 L506S probably damaging Het
Ttc37 T A 13: 76,134,770 V737D probably damaging Het
Uggt1 T C 1: 36,179,613 I78V probably damaging Het
Xpo4 A T 14: 57,590,871 V844D probably damaging Het
Zfp507 C T 7: 35,793,725 R631Q probably damaging Het
Other mutations in Fmn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Fmn1 APN 2 113444467 intron probably benign
IGL01520:Fmn1 APN 2 113444368 intron probably benign
IGL02039:Fmn1 APN 2 113365080 missense unknown
IGL02222:Fmn1 APN 2 113593109 missense probably damaging 1.00
IGL02238:Fmn1 APN 2 113582125 missense possibly damaging 0.90
IGL02373:Fmn1 APN 2 113364126 missense unknown
IGL02490:Fmn1 APN 2 113529472 splice site probably benign
IGL02506:Fmn1 APN 2 113525295 missense unknown
IGL02684:Fmn1 APN 2 113525277 missense unknown
IGL03008:Fmn1 APN 2 113365100 missense unknown
IGL03058:Fmn1 APN 2 113441814 intron probably benign
IGL03076:Fmn1 APN 2 113584092 missense probably damaging 0.99
FR4304:Fmn1 UTSW 2 113525774 small insertion probably benign
FR4304:Fmn1 UTSW 2 113525783 small insertion probably benign
FR4342:Fmn1 UTSW 2 113525783 small insertion probably benign
FR4589:Fmn1 UTSW 2 113525773 small insertion probably benign
FR4589:Fmn1 UTSW 2 113525774 small insertion probably benign
FR4737:Fmn1 UTSW 2 113525778 small insertion probably benign
FR4737:Fmn1 UTSW 2 113525781 small insertion probably benign
FR4737:Fmn1 UTSW 2 113525784 small insertion probably benign
R0349:Fmn1 UTSW 2 113365796 missense unknown
R0452:Fmn1 UTSW 2 113636779 missense possibly damaging 0.46
R0529:Fmn1 UTSW 2 113707853 splice site probably benign
R1215:Fmn1 UTSW 2 113693030 nonsense probably null
R1471:Fmn1 UTSW 2 113693094 missense possibly damaging 0.95
R1489:Fmn1 UTSW 2 113365212 missense unknown
R1491:Fmn1 UTSW 2 113596369 missense probably damaging 1.00
R1551:Fmn1 UTSW 2 113525862 missense possibly damaging 0.70
R1558:Fmn1 UTSW 2 113693118 missense possibly damaging 0.46
R1588:Fmn1 UTSW 2 113365698 missense unknown
R1602:Fmn1 UTSW 2 113525623 missense unknown
R1690:Fmn1 UTSW 2 113525482 missense unknown
R1772:Fmn1 UTSW 2 113365355 missense unknown
R1867:Fmn1 UTSW 2 113709438 missense probably damaging 1.00
R1941:Fmn1 UTSW 2 113365143 missense unknown
R2019:Fmn1 UTSW 2 113364480 missense unknown
R2140:Fmn1 UTSW 2 113595048 missense probably benign 0.45
R2164:Fmn1 UTSW 2 113365617 missense unknown
R2395:Fmn1 UTSW 2 113365181 missense unknown
R2999:Fmn1 UTSW 2 113365094 missense unknown
R3405:Fmn1 UTSW 2 113364348 missense unknown
R3407:Fmn1 UTSW 2 113365055 missense unknown
R3771:Fmn1 UTSW 2 113582118 missense probably damaging 1.00
R3772:Fmn1 UTSW 2 113582118 missense probably damaging 1.00
R3773:Fmn1 UTSW 2 113582118 missense probably damaging 1.00
R3777:Fmn1 UTSW 2 113365122 missense unknown
R4166:Fmn1 UTSW 2 113636735 missense probably benign 0.33
R4477:Fmn1 UTSW 2 113444399 intron probably benign
R4614:Fmn1 UTSW 2 113365149 missense unknown
R4701:Fmn1 UTSW 2 113584071 missense possibly damaging 0.76
R4867:Fmn1 UTSW 2 113584120 critical splice donor site probably null
R5063:Fmn1 UTSW 2 113364921 missense unknown
R5224:Fmn1 UTSW 2 113365125 missense unknown
R5510:Fmn1 UTSW 2 113596369 missense probably damaging 1.00
R6083:Fmn1 UTSW 2 113364303 missense unknown
R6234:Fmn1 UTSW 2 113365655 missense unknown
R6266:Fmn1 UTSW 2 113596338 missense probably damaging 1.00
R6764:Fmn1 UTSW 2 113525215 missense unknown
R7054:Fmn1 UTSW 2 113365008 missense unknown
R7311:Fmn1 UTSW 2 113525680 missense unknown
R7439:Fmn1 UTSW 2 113441611 missense unknown
R7440:Fmn1 UTSW 2 113441611 missense unknown
R7441:Fmn1 UTSW 2 113441611 missense unknown
R7444:Fmn1 UTSW 2 113441611 missense unknown
R7461:Fmn1 UTSW 2 113364071 missense unknown
R7526:Fmn1 UTSW 2 113688134 missense probably damaging 0.99
R7540:Fmn1 UTSW 2 113529310 splice site probably null
R7576:Fmn1 UTSW 2 113365008 missense unknown
R7657:Fmn1 UTSW 2 113525193 missense unknown
R7669:Fmn1 UTSW 2 113365477 missense unknown
R7713:Fmn1 UTSW 2 113525814 missense unknown
R7841:Fmn1 UTSW 2 113529465 critical splice donor site probably null
R7924:Fmn1 UTSW 2 113529465 critical splice donor site probably null
R8041:Fmn1 UTSW 2 113364594 missense unknown
RF003:Fmn1 UTSW 2 113525786 small insertion probably benign
RF023:Fmn1 UTSW 2 113525786 small insertion probably benign
Z1088:Fmn1 UTSW 2 113441925 intron probably benign
Predicted Primers PCR Primer
(F):5'- GCCTTGTAGAATCCCTAAACTTG -3'
(R):5'- CTTGGTTTGCGGTAGTCCAC -3'

Sequencing Primer
(F):5'- CTTGTAGAATCCCTAAACTTGCTGAC -3'
(R):5'- GCCTCAGCAACTTTACATGTAG -3'
Posted On2014-07-14