Incidental Mutation 'R0125:Utp15'
ID21321
Institutional Source Beutler Lab
Gene Symbol Utp15
Ensembl Gene ENSMUSG00000041747
Gene NameUTP15 small subunit processome component
Synonyms
MMRRC Submission 038410-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.970) question?
Stock #R0125 (G1)
Quality Score225
Status Validated (trace)
Chromosome13
Chromosomal Location98246845-98263041 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 98250882 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 395 (S395P)
Ref Sequence ENSEMBL: ENSMUSP00000048204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040972]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040972
AA Change: S395P

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000048204
Gene: ENSMUSG00000041747
AA Change: S395P

DomainStartEndE-ValueType
WD40 31 66 6.85e1 SMART
WD40 69 108 1.66e-5 SMART
WD40 111 150 2.82e-8 SMART
WD40 153 193 7.33e-7 SMART
WD40 196 233 3.9e-2 SMART
WD40 237 276 1.39e-7 SMART
WD40 279 317 1.7e2 SMART
Pfam:UTP15_C 343 490 3.5e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224842
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225100
Meta Mutation Damage Score 0.4957 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.7%
  • 20x: 87.1%
Validation Efficiency 98% (96/98)
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930012K11Rik T C 14: 70,156,647 probably benign Het
Adam23 T C 1: 63,534,356 L261P probably benign Het
Adgra3 G A 5: 50,001,852 probably benign Het
Agtr1b A G 3: 20,315,540 F301L probably benign Het
Ahnak2 G A 12: 112,785,156 T357I probably benign Het
Aldh1a7 T C 19: 20,727,066 probably benign Het
Apoh A T 11: 108,412,073 N288I probably damaging Het
Arfgap3 A G 15: 83,343,139 V24A probably benign Het
Atp6v0a1 A G 11: 101,038,851 probably null Het
Axl A T 7: 25,786,943 M112K probably benign Het
Bnc2 A C 4: 84,292,932 I425S probably damaging Het
Cdc42bpa C T 1: 179,961,198 T30M probably damaging Het
Cebpz C A 17: 78,919,888 R1051M possibly damaging Het
Ces1d A C 8: 93,175,182 probably benign Het
Chd1l T C 3: 97,587,149 N405S probably benign Het
Chodl G T 16: 78,941,423 G93V probably damaging Het
Cpeb2 C T 5: 43,238,400 probably benign Het
Crebbp A G 16: 4,117,241 probably benign Het
Crybb3 T C 5: 113,079,809 T49A possibly damaging Het
Ctps A G 4: 120,561,525 probably benign Het
Cyp26b1 A G 6: 84,574,515 Y240H probably damaging Het
Cyp2d11 A C 15: 82,389,221 V483G probably benign Het
Dnah14 A T 1: 181,752,063 N3054Y probably damaging Het
Dspp A C 5: 104,178,039 D756A unknown Het
Dst T C 1: 34,270,903 S1553P probably damaging Het
Elp4 A G 2: 105,792,214 probably null Het
Eml6 G T 11: 29,882,088 T194K probably benign Het
Evi5 A G 5: 107,795,772 I569T probably benign Het
Fam129b T A 2: 32,923,821 V682D probably benign Het
Fancm C T 12: 65,121,956 P1698S possibly damaging Het
Fhdc1 T C 3: 84,445,545 D791G probably benign Het
Frem1 A G 4: 83,011,951 Y253H probably damaging Het
Gpn3 A G 5: 122,381,418 Y196C probably benign Het
Hcls1 A G 16: 36,962,163 D398G probably benign Het
Hydin T C 8: 110,462,531 V1189A probably benign Het
Itgb3 G A 11: 104,643,963 D549N probably damaging Het
Itpr2 A G 6: 146,240,453 F1697S probably benign Het
Klk1b11 A G 7: 43,999,051 T161A probably benign Het
Kntc1 G A 5: 123,765,057 probably benign Het
Map3k19 A T 1: 127,823,100 F838Y probably benign Het
Map6 T A 7: 99,335,980 probably null Het
Mcrs1 A G 15: 99,244,727 probably benign Het
Mdn1 A T 4: 32,729,956 Y2766F probably damaging Het
Med23 C T 10: 24,900,788 H739Y probably damaging Het
Mmp17 T A 5: 129,594,582 D65E possibly damaging Het
Mmp9 T A 2: 164,951,257 L442Q probably damaging Het
Myo19 T C 11: 84,888,175 probably benign Het
Nedd1 A C 10: 92,691,929 S468A possibly damaging Het
Nlrp4d A C 7: 10,382,389 V152G probably damaging Het
Nxf1 T A 19: 8,762,806 D112E probably benign Het
Oas1h A T 5: 120,862,563 K79* probably null Het
Olfr494 A G 7: 108,368,369 Y293C probably damaging Het
Olfr888 A G 9: 38,109,519 T278A probably benign Het
Olfr904 T A 9: 38,464,461 L140* probably null Het
Omg T A 11: 79,502,853 I60F possibly damaging Het
Pck1 G A 2: 173,156,081 W314* probably null Het
Pla2g15 T C 8: 106,163,124 Y343H probably benign Het
Plcb3 T C 19: 6,958,908 E749G probably damaging Het
Plgrkt A G 19: 29,351,042 probably null Het
Pprc1 A G 19: 46,069,512 probably benign Het
Prkdc A T 16: 15,699,007 I1082F probably damaging Het
Rapgef6 T A 11: 54,625,875 Y172* probably null Het
Ros1 G T 10: 52,125,789 A1079D probably benign Het
Sap30 T C 8: 57,485,511 E147G probably null Het
Sell T C 1: 164,072,105 probably benign Het
Senp1 A T 15: 98,048,231 D544E probably damaging Het
Shpk G A 11: 73,214,222 probably benign Het
Slc35b1 A T 11: 95,386,527 T74S probably benign Het
Slc6a3 T A 13: 73,569,979 probably benign Het
Slf1 T C 13: 77,043,745 N990S probably benign Het
Smgc A G 15: 91,854,543 probably benign Het
Snx19 T A 9: 30,440,219 V861D probably damaging Het
Sprr2e C T 3: 92,352,978 P39S unknown Het
Sstr2 T A 11: 113,624,477 M74K probably damaging Het
St5 T C 7: 109,556,338 K402E probably benign Het
Svep1 T C 4: 58,099,937 probably benign Het
Tas2r143 A G 6: 42,400,955 I240V probably benign Het
Tbrg1 T C 9: 37,652,641 I233V probably benign Het
Tecpr1 G T 5: 144,197,899 D1055E probably damaging Het
Thap2 A T 10: 115,376,372 probably null Het
Tinagl1 A G 4: 130,166,308 Y388H probably damaging Het
Ttn T A 2: 76,755,552 Y21945F probably damaging Het
Ugt2b1 A T 5: 86,926,102 W133R probably benign Het
Usp24 C T 4: 106,397,299 P1491L possibly damaging Het
Vav1 T A 17: 57,299,847 L254Q probably damaging Het
Vmn2r104 T C 17: 20,029,807 Y734C probably damaging Het
Vps8 T A 16: 21,470,154 V421E probably benign Het
Wisp1 T C 15: 66,917,345 S227P possibly damaging Het
Xkr7 G T 2: 153,032,426 A138S probably benign Het
Other mutations in Utp15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02951:Utp15 APN 13 98257952 missense probably damaging 1.00
IGL02960:Utp15 APN 13 98252881 missense probably benign 0.30
IGL03271:Utp15 APN 13 98253694 missense probably damaging 1.00
R0679:Utp15 UTSW 13 98259403 missense probably benign 0.13
R1447:Utp15 UTSW 13 98252878 missense possibly damaging 0.68
R1618:Utp15 UTSW 13 98257187 missense probably benign 0.16
R1992:Utp15 UTSW 13 98250912 missense probably benign
R2110:Utp15 UTSW 13 98254985 missense probably damaging 1.00
R2263:Utp15 UTSW 13 98257925 missense probably benign 0.03
R3888:Utp15 UTSW 13 98259166 missense probably benign 0.00
R4355:Utp15 UTSW 13 98259247 missense possibly damaging 0.48
R5436:Utp15 UTSW 13 98260846 unclassified probably null
R5568:Utp15 UTSW 13 98257925 missense probably benign 0.03
R6489:Utp15 UTSW 13 98250609 missense probably damaging 0.96
R8116:Utp15 UTSW 13 98250863 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCATTAATCAAAACAGGGGCGAACC -3'
(R):5'- AACCTGGGGCTAGGACATGTGG -3'

Sequencing Primer
(F):5'- GGCTGAGACAGATTCCTGC -3'
(R):5'- AGCTTGGCGTTTACTGCA -3'
Posted On2013-04-11