Incidental Mutation 'R1923:Nat8f4'
ID213214
Institutional Source Beutler Lab
Gene Symbol Nat8f4
Ensembl Gene ENSMUSG00000068299
Gene NameN-acetyltransferase 8 (GCN5-related) family member 4
Synonyms1700019G17Rik
MMRRC Submission 039941-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R1923 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location85899051-85904884 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85901515 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 9 (Y9H)
Ref Sequence ENSEMBL: ENSMUSP00000093430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095757] [ENSMUST00000159755]
Predicted Effect probably damaging
Transcript: ENSMUST00000095757
AA Change: Y9H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093430
Gene: ENSMUSG00000068299
AA Change: Y9H

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
Pfam:Acetyltransf_10 75 192 2.5e-11 PFAM
Pfam:Acetyltransf_8 83 200 2.1e-11 PFAM
Pfam:Acetyltransf_7 104 194 3.3e-14 PFAM
Pfam:Acetyltransf_1 111 193 6.3e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000159755
AA Change: Y9H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124071
Gene: ENSMUSG00000068299
AA Change: Y9H

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
transmembrane domain 60 82 N/A INTRINSIC
low complexity region 117 130 N/A INTRINSIC
Meta Mutation Damage Score 0.3865 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.5%
  • 20x: 92.9%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik A T 18: 57,533,887 D12V probably damaging Het
2610008E11Rik T C 10: 79,067,909 E163G probably damaging Het
4921513D11Rik A G 17: 79,628,133 probably benign Het
Acox3 T A 5: 35,592,115 F195I possibly damaging Het
Acsl6 T C 11: 54,325,591 Y135H probably damaging Het
Ankhd1 C A 18: 36,648,030 A2045E probably benign Het
Ap5z1 A G 5: 142,472,341 H423R probably benign Het
Arsk T A 13: 76,066,866 probably benign Het
Bpi G A 2: 158,261,163 G76D probably damaging Het
Carmil3 A G 14: 55,502,404 T983A probably damaging Het
Chmp2b A T 16: 65,545,327 M125K possibly damaging Het
Clca3a2 T A 3: 144,805,730 I26L probably damaging Het
Cubn T C 2: 13,310,526 Y3032C probably damaging Het
Ehbp1 T A 11: 22,151,850 D226V probably damaging Het
Enpp6 A T 8: 47,082,506 D362V probably damaging Het
Fam53b A G 7: 132,715,792 S374P probably damaging Het
Fmn1 T C 2: 113,429,721 probably benign Het
Fndc7 C T 3: 108,876,687 R202H probably benign Het
Frmd4b T G 6: 97,288,454 D951A probably benign Het
Git2 A G 5: 114,739,101 Y107H probably damaging Het
Gm11595 A T 11: 99,772,539 V105E unknown Het
Krt26 CTAGTA CTA 11: 99,333,526 probably benign Het
Lrriq4 C A 3: 30,659,093 Q448K probably benign Het
Ly6g5c A G 17: 35,111,887 I128M possibly damaging Het
Mroh9 T A 1: 163,076,291 S51C probably damaging Het
Myh3 A G 11: 67,080,002 S2G probably benign Het
Negr1 T C 3: 156,562,199 V2A probably benign Het
Olfr1079 T G 2: 86,538,513 Y132S probably damaging Het
Olfr1385 C T 11: 49,495,304 T257I probably damaging Het
Olfr832 C T 9: 18,945,485 T279I probably benign Het
Otog G A 7: 46,246,283 C107Y probably damaging Het
Pdgfra C A 5: 75,163,733 T83K probably benign Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Retreg1 A G 15: 25,969,838 D109G probably damaging Het
Rgs12 T A 5: 35,032,269 W674R probably damaging Het
Rgs18 T C 1: 144,756,080 D98G possibly damaging Het
Rnf146 A G 10: 29,347,719 F57S probably damaging Het
Slc22a20 C A 19: 5,971,436 V513L probably benign Het
Stox2 G T 8: 47,193,626 F266L probably damaging Het
Tbx21 C T 11: 97,100,037 V272M probably damaging Het
Tmc7 A G 7: 118,545,627 F570S probably benign Het
Tmem236 T C 2: 14,219,306 I302T probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trpm3 T C 19: 22,885,412 L506S probably damaging Het
Ttc37 T A 13: 76,134,770 V737D probably damaging Het
Uggt1 T C 1: 36,179,613 I78V probably damaging Het
Xpo4 A T 14: 57,590,871 V844D probably damaging Het
Zfp507 C T 7: 35,793,725 R631Q probably damaging Het
Other mutations in Nat8f4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Nat8f4 APN 6 85900987 missense probably benign 0.05
IGL03072:Nat8f4 APN 6 85900854 intron probably benign
R1341:Nat8f4 UTSW 6 85901424 missense probably damaging 0.96
R1725:Nat8f4 UTSW 6 85901098 nonsense probably null
R2258:Nat8f4 UTSW 6 85901225 missense possibly damaging 0.84
R3975:Nat8f4 UTSW 6 85901070 missense possibly damaging 0.62
R4697:Nat8f4 UTSW 6 85901386 missense probably benign 0.01
R4784:Nat8f4 UTSW 6 85901499 missense probably benign 0.03
R4924:Nat8f4 UTSW 6 85901419 missense probably benign 0.03
R4991:Nat8f4 UTSW 6 85901140 missense probably benign 0.30
R6074:Nat8f4 UTSW 6 85901187 missense probably damaging 0.98
R7058:Nat8f4 UTSW 6 85901289 missense possibly damaging 0.73
R7790:Nat8f4 UTSW 6 85900891 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAAGCTGCATACTGTGGCC -3'
(R):5'- GATGGCTTGACACTTCTCTCTG -3'

Sequencing Primer
(F):5'- TGCATACTGTGGCCAGGAG -3'
(R):5'- CTCTCTGTAGTAGTGTCAACAGAGGC -3'
Posted On2014-07-14