Incidental Mutation 'R1923:Myh3'
ID213231
Institutional Source Beutler Lab
Gene Symbol Myh3
Ensembl Gene ENSMUSG00000020908
Gene Namemyosin, heavy polypeptide 3, skeletal muscle, embryonic
SynonymsMyhse, Myhs-e, MyHC-emb
MMRRC Submission 039941-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.583) question?
Stock #R1923 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location67078300-67102291 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 67080002 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 2 (S2G)
Ref Sequence ENSEMBL: ENSMUSP00000131883 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007301] [ENSMUST00000108689] [ENSMUST00000165221]
Predicted Effect probably benign
Transcript: ENSMUST00000007301
AA Change: S2G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000007301
Gene: ENSMUSG00000020908
AA Change: S2G

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 1.1e-14 PFAM
MYSc 80 780 N/A SMART
IQ 781 803 1.65e-2 SMART
IQ 807 829 2.25e2 SMART
low complexity region 844 856 N/A INTRINSIC
low complexity region 925 939 N/A INTRINSIC
low complexity region 1020 1028 N/A INTRINSIC
Pfam:Myosin_tail_1 1069 1927 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108689
AA Change: S2G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000104329
Gene: ENSMUSG00000020908
AA Change: S2G

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 1.1e-14 PFAM
MYSc 80 780 N/A SMART
IQ 781 803 1.65e-2 SMART
IQ 807 829 2.25e2 SMART
low complexity region 844 856 N/A INTRINSIC
low complexity region 925 939 N/A INTRINSIC
low complexity region 1020 1028 N/A INTRINSIC
Pfam:Myosin_tail_1 1069 1927 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165221
AA Change: S2G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000131883
Gene: ENSMUSG00000020908
AA Change: S2G

DomainStartEndE-ValueType
Pfam:Myosin_N 35 74 2.2e-13 PFAM
MYSc 80 780 N/A SMART
IQ 781 803 1.65e-2 SMART
IQ 807 829 2.25e2 SMART
Pfam:Myosin_tail_1 844 1925 2.1e-164 PFAM
Meta Mutation Damage Score 0.0925 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.5%
  • 20x: 92.9%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: Myosin is a major contractile protein which converts chemical energy into mechanical energy through the hydrolysis of ATP. Myosin is a hexameric protein composed of a pair of myosin heavy chains (MYH) and two pairs of nonidentical light chains. This gene is a member of the MYH family and encodes a protein with an IQ domain and a myosin head-like domain. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik A T 18: 57,533,887 D12V probably damaging Het
2610008E11Rik T C 10: 79,067,909 E163G probably damaging Het
4921513D11Rik A G 17: 79,628,133 probably benign Het
Acox3 T A 5: 35,592,115 F195I possibly damaging Het
Acsl6 T C 11: 54,325,591 Y135H probably damaging Het
Ankhd1 C A 18: 36,648,030 A2045E probably benign Het
Ap5z1 A G 5: 142,472,341 H423R probably benign Het
Arsk T A 13: 76,066,866 probably benign Het
Bpi G A 2: 158,261,163 G76D probably damaging Het
Carmil3 A G 14: 55,502,404 T983A probably damaging Het
Chmp2b A T 16: 65,545,327 M125K possibly damaging Het
Clca3a2 T A 3: 144,805,730 I26L probably damaging Het
Cubn T C 2: 13,310,526 Y3032C probably damaging Het
Ehbp1 T A 11: 22,151,850 D226V probably damaging Het
Enpp6 A T 8: 47,082,506 D362V probably damaging Het
Fam53b A G 7: 132,715,792 S374P probably damaging Het
Fmn1 T C 2: 113,429,721 probably benign Het
Fndc7 C T 3: 108,876,687 R202H probably benign Het
Frmd4b T G 6: 97,288,454 D951A probably benign Het
Git2 A G 5: 114,739,101 Y107H probably damaging Het
Gm11595 A T 11: 99,772,539 V105E unknown Het
Krt26 CTAGTA CTA 11: 99,333,526 probably benign Het
Lrriq4 C A 3: 30,659,093 Q448K probably benign Het
Ly6g5c A G 17: 35,111,887 I128M possibly damaging Het
Mroh9 T A 1: 163,076,291 S51C probably damaging Het
Nat8f4 A G 6: 85,901,515 Y9H probably damaging Het
Negr1 T C 3: 156,562,199 V2A probably benign Het
Olfr1079 T G 2: 86,538,513 Y132S probably damaging Het
Olfr1385 C T 11: 49,495,304 T257I probably damaging Het
Olfr832 C T 9: 18,945,485 T279I probably benign Het
Otog G A 7: 46,246,283 C107Y probably damaging Het
Pdgfra C A 5: 75,163,733 T83K probably benign Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Retreg1 A G 15: 25,969,838 D109G probably damaging Het
Rgs12 T A 5: 35,032,269 W674R probably damaging Het
Rgs18 T C 1: 144,756,080 D98G possibly damaging Het
Rnf146 A G 10: 29,347,719 F57S probably damaging Het
Slc22a20 C A 19: 5,971,436 V513L probably benign Het
Stox2 G T 8: 47,193,626 F266L probably damaging Het
Tbx21 C T 11: 97,100,037 V272M probably damaging Het
Tmc7 A G 7: 118,545,627 F570S probably benign Het
Tmem236 T C 2: 14,219,306 I302T probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trpm3 T C 19: 22,885,412 L506S probably damaging Het
Ttc37 T A 13: 76,134,770 V737D probably damaging Het
Uggt1 T C 1: 36,179,613 I78V probably damaging Het
Xpo4 A T 14: 57,590,871 V844D probably damaging Het
Zfp507 C T 7: 35,793,725 R631Q probably damaging Het
Other mutations in Myh3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Myh3 APN 11 67090855 missense probably damaging 1.00
IGL01989:Myh3 APN 11 67086655 missense probably damaging 1.00
IGL02097:Myh3 APN 11 67082924 missense probably benign
IGL02197:Myh3 APN 11 67098583 missense probably benign 0.05
IGL02458:Myh3 APN 11 67096940 missense possibly damaging 0.87
IGL02526:Myh3 APN 11 67087545 missense probably benign 0.01
IGL02559:Myh3 APN 11 67101095 missense possibly damaging 0.94
IGL02600:Myh3 APN 11 67083401 missense probably damaging 1.00
IGL02866:Myh3 APN 11 67089023 missense probably benign 0.08
IGL02943:Myh3 APN 11 67091065 missense probably benign 0.02
IGL03087:Myh3 APN 11 67090972 missense probably damaging 1.00
IGL03131:Myh3 APN 11 67091109 splice site probably benign
bud UTSW 11 67096007 critical splice acceptor site probably null
R0049:Myh3 UTSW 11 67099672 missense probably damaging 1.00
R0157:Myh3 UTSW 11 67082909 missense probably benign 0.00
R0266:Myh3 UTSW 11 67093672 missense possibly damaging 0.73
R0352:Myh3 UTSW 11 67090428 missense possibly damaging 0.79
R0391:Myh3 UTSW 11 67096507 splice site probably benign
R0926:Myh3 UTSW 11 67090514 splice site probably null
R1243:Myh3 UTSW 11 67090453 missense possibly damaging 0.80
R1344:Myh3 UTSW 11 67092332 missense probably benign 0.03
R1414:Myh3 UTSW 11 67098665 missense probably damaging 0.98
R1442:Myh3 UTSW 11 67087277 missense possibly damaging 0.77
R1470:Myh3 UTSW 11 67098059 splice site probably benign
R1480:Myh3 UTSW 11 67093545 missense possibly damaging 0.88
R1598:Myh3 UTSW 11 67093171 missense probably damaging 1.00
R1620:Myh3 UTSW 11 67088736 splice site probably benign
R1682:Myh3 UTSW 11 67089065 missense probably damaging 1.00
R1759:Myh3 UTSW 11 67096891 missense probably damaging 0.98
R1772:Myh3 UTSW 11 67099394 missense probably benign 0.32
R1868:Myh3 UTSW 11 67085026 missense probably benign 0.34
R1874:Myh3 UTSW 11 67093179 missense probably benign 0.03
R1885:Myh3 UTSW 11 67086627 missense probably benign 0.23
R2145:Myh3 UTSW 11 67091056 missense probably benign
R3973:Myh3 UTSW 11 67096436 nonsense probably null
R4410:Myh3 UTSW 11 67085032 missense possibly damaging 0.71
R4583:Myh3 UTSW 11 67096453 nonsense probably null
R4650:Myh3 UTSW 11 67086444 missense probably damaging 1.00
R4822:Myh3 UTSW 11 67089010 missense probably benign
R4836:Myh3 UTSW 11 67096939 missense probably benign 0.01
R4898:Myh3 UTSW 11 67099407 missense probably benign 0.05
R4946:Myh3 UTSW 11 67093538 missense probably benign
R5506:Myh3 UTSW 11 67084089 missense probably damaging 1.00
R5534:Myh3 UTSW 11 67097044 missense probably damaging 1.00
R5733:Myh3 UTSW 11 67088619 missense probably benign 0.24
R5889:Myh3 UTSW 11 67086375 missense probably damaging 1.00
R6056:Myh3 UTSW 11 67087545 missense probably benign 0.01
R6223:Myh3 UTSW 11 67098017 missense probably benign
R6228:Myh3 UTSW 11 67087486 missense probably benign 0.17
R6341:Myh3 UTSW 11 67082996 missense probably benign 0.00
R6434:Myh3 UTSW 11 67082367 missense probably damaging 1.00
R6533:Myh3 UTSW 11 67090419 missense probably damaging 0.96
R6812:Myh3 UTSW 11 67086402 missense probably damaging 0.99
R7336:Myh3 UTSW 11 67091021 missense probably benign 0.13
R7354:Myh3 UTSW 11 67096882 missense probably damaging 1.00
R7498:Myh3 UTSW 11 67097048 missense possibly damaging 0.96
R7532:Myh3 UTSW 11 67091095 missense probably benign
R7841:Myh3 UTSW 11 67098692 missense probably damaging 1.00
R7878:Myh3 UTSW 11 67087251 missense probably damaging 1.00
R8169:Myh3 UTSW 11 67089030 missense probably benign 0.06
R8194:Myh3 UTSW 11 67092002 missense probably damaging 1.00
R8215:Myh3 UTSW 11 67101179 missense probably damaging 0.99
R8240:Myh3 UTSW 11 67092370 missense probably benign 0.01
R8255:Myh3 UTSW 11 67095022 missense probably damaging 1.00
R8310:Myh3 UTSW 11 67096007 critical splice acceptor site probably null
RF009:Myh3 UTSW 11 67086355 frame shift probably null
RF009:Myh3 UTSW 11 67086356 frame shift probably null
RF009:Myh3 UTSW 11 67086357 frame shift probably null
RF010:Myh3 UTSW 11 67086356 frame shift probably null
RF010:Myh3 UTSW 11 67086359 frame shift probably null
RF013:Myh3 UTSW 11 67086356 frame shift probably null
RF015:Myh3 UTSW 11 67086356 frame shift probably null
X0060:Myh3 UTSW 11 67094998 missense probably benign 0.00
X0062:Myh3 UTSW 11 67089116 missense probably benign 0.03
Z1176:Myh3 UTSW 11 67082415 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- TGAACCCTTGTGTGAAGCGC -3'
(R):5'- GAGAAAGAGCAAGTGCCTTACC -3'

Sequencing Primer
(F):5'- CTTGTGTGAAGCGCCACTG -3'
(R):5'- AGCAAGTGCCTTACCCTGCTG -3'
Posted On2014-07-14