Incidental Mutation 'R1923:Gm11595'
ID213234
Institutional Source Beutler Lab
Gene Symbol Gm11595
Ensembl Gene ENSMUSG00000078668
Gene Namepredicted gene 11595
Synonyms
MMRRC Submission 039941-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R1923 (G1)
Quality Score207
Status Validated
Chromosome11
Chromosomal Location99771714-99772913 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 99772539 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 105 (V105E)
Ref Sequence ENSEMBL: ENSMUSP00000103064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107440]
Predicted Effect unknown
Transcript: ENSMUST00000107440
AA Change: V105E
SMART Domains Protein: ENSMUSP00000103064
Gene: ENSMUSG00000078668
AA Change: V105E

DomainStartEndE-ValueType
Pfam:Keratin_B2_2 1 47 7.5e-9 PFAM
Pfam:Keratin_B2_2 14 58 2.8e-13 PFAM
Pfam:Keratin_B2_2 29 73 1.2e-13 PFAM
Pfam:Keratin_B2_2 72 112 2.3e-12 PFAM
Pfam:Keratin_B2_2 107 152 4.6e-14 PFAM
Pfam:Keratin_B2_2 118 162 1.1e-13 PFAM
Pfam:Keratin_B2_2 143 187 3.5e-10 PFAM
Pfam:Keratin_B2_2 168 212 5.6e-13 PFAM
Pfam:Keratin_B2_2 178 222 2.4e-12 PFAM
Pfam:Keratin_B2_2 208 257 1.6e-11 PFAM
Pfam:Keratin_B2_2 223 267 4e-14 PFAM
Pfam:Keratin_B2_2 248 289 9e-9 PFAM
Meta Mutation Damage Score 0.1442 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.5%
  • 20x: 92.9%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik A T 18: 57,533,887 D12V probably damaging Het
2610008E11Rik T C 10: 79,067,909 E163G probably damaging Het
4921513D11Rik A G 17: 79,628,133 probably benign Het
Acox3 T A 5: 35,592,115 F195I possibly damaging Het
Acsl6 T C 11: 54,325,591 Y135H probably damaging Het
Ankhd1 C A 18: 36,648,030 A2045E probably benign Het
Ap5z1 A G 5: 142,472,341 H423R probably benign Het
Arsk T A 13: 76,066,866 probably benign Het
Bpi G A 2: 158,261,163 G76D probably damaging Het
Carmil3 A G 14: 55,502,404 T983A probably damaging Het
Chmp2b A T 16: 65,545,327 M125K possibly damaging Het
Clca3a2 T A 3: 144,805,730 I26L probably damaging Het
Cubn T C 2: 13,310,526 Y3032C probably damaging Het
Ehbp1 T A 11: 22,151,850 D226V probably damaging Het
Enpp6 A T 8: 47,082,506 D362V probably damaging Het
Fam53b A G 7: 132,715,792 S374P probably damaging Het
Fmn1 T C 2: 113,429,721 probably benign Het
Fndc7 C T 3: 108,876,687 R202H probably benign Het
Frmd4b T G 6: 97,288,454 D951A probably benign Het
Git2 A G 5: 114,739,101 Y107H probably damaging Het
Krt26 CTAGTA CTA 11: 99,333,526 probably benign Het
Lrriq4 C A 3: 30,659,093 Q448K probably benign Het
Ly6g5c A G 17: 35,111,887 I128M possibly damaging Het
Mroh9 T A 1: 163,076,291 S51C probably damaging Het
Myh3 A G 11: 67,080,002 S2G probably benign Het
Nat8f4 A G 6: 85,901,515 Y9H probably damaging Het
Negr1 T C 3: 156,562,199 V2A probably benign Het
Olfr1079 T G 2: 86,538,513 Y132S probably damaging Het
Olfr1385 C T 11: 49,495,304 T257I probably damaging Het
Olfr832 C T 9: 18,945,485 T279I probably benign Het
Otog G A 7: 46,246,283 C107Y probably damaging Het
Pdgfra C A 5: 75,163,733 T83K probably benign Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Retreg1 A G 15: 25,969,838 D109G probably damaging Het
Rgs12 T A 5: 35,032,269 W674R probably damaging Het
Rgs18 T C 1: 144,756,080 D98G possibly damaging Het
Rnf146 A G 10: 29,347,719 F57S probably damaging Het
Slc22a20 C A 19: 5,971,436 V513L probably benign Het
Stox2 G T 8: 47,193,626 F266L probably damaging Het
Tbx21 C T 11: 97,100,037 V272M probably damaging Het
Tmc7 A G 7: 118,545,627 F570S probably benign Het
Tmem236 T C 2: 14,219,306 I302T probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trpm3 T C 19: 22,885,412 L506S probably damaging Het
Ttc37 T A 13: 76,134,770 V737D probably damaging Het
Uggt1 T C 1: 36,179,613 I78V probably damaging Het
Xpo4 A T 14: 57,590,871 V844D probably damaging Het
Zfp507 C T 7: 35,793,725 R631Q probably damaging Het
Other mutations in Gm11595
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00579:Gm11595 APN 11 99772042 missense unknown
IGL00987:Gm11595 APN 11 99772539 missense unknown
IGL01662:Gm11595 APN 11 99772672 missense unknown
IGL01994:Gm11595 APN 11 99772201 missense unknown
R0548:Gm11595 UTSW 11 99772141 missense unknown
R2127:Gm11595 UTSW 11 99772501 missense unknown
R2128:Gm11595 UTSW 11 99772501 missense unknown
R3807:Gm11595 UTSW 11 99772554 missense unknown
R4007:Gm11595 UTSW 11 99772035 missense unknown
R5281:Gm11595 UTSW 11 99772555 missense unknown
R5283:Gm11595 UTSW 11 99772555 missense unknown
R5303:Gm11595 UTSW 11 99772555 missense unknown
R5305:Gm11595 UTSW 11 99772555 missense unknown
R5306:Gm11595 UTSW 11 99772555 missense unknown
R5307:Gm11595 UTSW 11 99772555 missense unknown
R5308:Gm11595 UTSW 11 99772555 missense unknown
R5561:Gm11595 UTSW 11 99772555 missense unknown
R5637:Gm11595 UTSW 11 99772555 missense unknown
R5639:Gm11595 UTSW 11 99772555 missense unknown
R5718:Gm11595 UTSW 11 99772555 missense unknown
R5719:Gm11595 UTSW 11 99772555 missense unknown
R5720:Gm11595 UTSW 11 99772555 missense unknown
R5721:Gm11595 UTSW 11 99772555 missense unknown
R5769:Gm11595 UTSW 11 99772555 missense unknown
R5770:Gm11595 UTSW 11 99772555 missense unknown
R5771:Gm11595 UTSW 11 99772555 missense unknown
R5791:Gm11595 UTSW 11 99772555 missense unknown
R5841:Gm11595 UTSW 11 99772317 missense unknown
R6054:Gm11595 UTSW 11 99772648 missense unknown
R6277:Gm11595 UTSW 11 99772684 missense unknown
R6281:Gm11595 UTSW 11 99772555 missense unknown
R6282:Gm11595 UTSW 11 99772555 missense unknown
R6310:Gm11595 UTSW 11 99772555 missense unknown
R6321:Gm11595 UTSW 11 99772555 missense unknown
R6322:Gm11595 UTSW 11 99772555 missense unknown
R6327:Gm11595 UTSW 11 99772555 missense unknown
R6337:Gm11595 UTSW 11 99772555 missense unknown
R6368:Gm11595 UTSW 11 99772555 missense unknown
R6369:Gm11595 UTSW 11 99772555 missense unknown
R6431:Gm11595 UTSW 11 99772774 missense unknown
R6483:Gm11595 UTSW 11 99772555 missense unknown
R6485:Gm11595 UTSW 11 99772555 missense unknown
R6493:Gm11595 UTSW 11 99772555 missense unknown
R6758:Gm11595 UTSW 11 99772540 missense unknown
R6758:Gm11595 UTSW 11 99772541 nonsense probably null
R7037:Gm11595 UTSW 11 99772648 missense unknown
R8053:Gm11595 UTSW 11 99772128 missense unknown
Predicted Primers PCR Primer
(F):5'- TAGAACTACCACAGCAGGGG -3'
(R):5'- ACCATGGTCAGTTCCTGTTGTG -3'

Sequencing Primer
(F):5'- GCGACAGCAGCTGGAGATG -3'
(R):5'- TGCCAGACCACCTGCTGTAG -3'
Posted On2014-07-14