Incidental Mutation 'R1923:Pdlim2'
ID 213239
Institutional Source Beutler Lab
Gene Symbol Pdlim2
Ensembl Gene ENSMUSG00000022090
Gene Name PDZ and LIM domain 2
Synonyms SLIM, 4732462F18Rik, mystique
MMRRC Submission 039941-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.074) question?
Stock # R1923 (G1)
Quality Score 115
Status Validated
Chromosome 14
Chromosomal Location 70401667-70415130 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 70402228 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 296 (R296H)
Ref Sequence ENSEMBL: ENSMUSP00000116200 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022681] [ENSMUST00000127836] [ENSMUST00000129174] [ENSMUST00000153735] [ENSMUST00000143393]
AlphaFold Q8R1G6
Predicted Effect probably damaging
Transcript: ENSMUST00000022681
AA Change: R296H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022681
Gene: ENSMUSG00000022090
AA Change: R296H

DomainStartEndE-ValueType
PDZ 11 84 3.41e-17 SMART
low complexity region 129 144 N/A INTRINSIC
Pfam:DUF4749 169 256 4.4e-12 PFAM
low complexity region 259 271 N/A INTRINSIC
LIM 282 334 1.25e-6 SMART
Predicted Effect unknown
Transcript: ENSMUST00000125300
AA Change: R97H
SMART Domains Protein: ENSMUSP00000116694
Gene: ENSMUSG00000022090
AA Change: R97H

DomainStartEndE-ValueType
Pfam:DUF4749 7 58 6.4e-13 PFAM
low complexity region 61 73 N/A INTRINSIC
LIM 84 136 1.25e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000127836
AA Change: R75H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141050
Gene: ENSMUSG00000022090
AA Change: R75H

DomainStartEndE-ValueType
low complexity region 20 29 N/A INTRINSIC
low complexity region 38 50 N/A INTRINSIC
LIM 61 113 5.9e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000129174
AA Change: R75H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139820
Gene: ENSMUSG00000022090
AA Change: R75H

DomainStartEndE-ValueType
low complexity region 20 29 N/A INTRINSIC
low complexity region 38 50 N/A INTRINSIC
LIM 61 113 5.9e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135944
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141363
Predicted Effect probably damaging
Transcript: ENSMUST00000153735
AA Change: R296H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116200
Gene: ENSMUSG00000022090
AA Change: R296H

DomainStartEndE-ValueType
PDZ 11 84 3.41e-17 SMART
low complexity region 129 144 N/A INTRINSIC
low complexity region 199 210 N/A INTRINSIC
low complexity region 241 250 N/A INTRINSIC
low complexity region 259 271 N/A INTRINSIC
LIM 282 334 1.25e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143393
SMART Domains Protein: ENSMUSP00000119222
Gene: ENSMUSG00000022090

DomainStartEndE-ValueType
PDZ 11 84 3.41e-17 SMART
low complexity region 129 144 N/A INTRINSIC
low complexity region 199 210 N/A INTRINSIC
Meta Mutation Damage Score 0.8007 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.5%
  • 20x: 92.9%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ALP subfamily of PDZ-LIM domain proteins. The encoded protein suppresses anchorage-dependent growth and promotes cell migration and adhesion through interactions with the actin cytoskeleton via the PDZ domain. The encoded protein is also a putative tumor suppressor protein, and decreased expression of this gene is associated with several malignancies including breast cancer and adult T-cell leukemia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele display increased IFN-gamma production by Th1 cells and an enhanced inflammatory response to in vivo challenge with heat-killed Listeria monocytogenes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T C 10: 78,903,743 (GRCm39) E163G probably damaging Het
4921513D11Rik A G 17: 79,935,562 (GRCm39) probably benign Het
Acox3 T A 5: 35,749,459 (GRCm39) F195I possibly damaging Het
Acsl6 T C 11: 54,216,417 (GRCm39) Y135H probably damaging Het
Ankhd1 C A 18: 36,781,083 (GRCm39) A2045E probably benign Het
Ap5z1 A G 5: 142,458,096 (GRCm39) H423R probably benign Het
Arsk T A 13: 76,214,985 (GRCm39) probably benign Het
Bpi G A 2: 158,103,083 (GRCm39) G76D probably damaging Het
Carmil3 A G 14: 55,739,861 (GRCm39) T983A probably damaging Het
Ccdc192 A T 18: 57,666,959 (GRCm39) D12V probably damaging Het
Chmp2b A T 16: 65,342,213 (GRCm39) M125K possibly damaging Het
Clca3a2 T A 3: 144,511,491 (GRCm39) I26L probably damaging Het
Cubn T C 2: 13,315,337 (GRCm39) Y3032C probably damaging Het
Ehbp1 T A 11: 22,101,850 (GRCm39) D226V probably damaging Het
Enpp6 A T 8: 47,535,541 (GRCm39) D362V probably damaging Het
Fam53b A G 7: 132,317,521 (GRCm39) S374P probably damaging Het
Fmn1 T C 2: 113,260,066 (GRCm39) probably benign Het
Fndc7 C T 3: 108,784,003 (GRCm39) R202H probably benign Het
Frmd4b T G 6: 97,265,415 (GRCm39) D951A probably benign Het
Git2 A G 5: 114,877,162 (GRCm39) Y107H probably damaging Het
Gm11595 A T 11: 99,663,365 (GRCm39) V105E unknown Het
Krt26 CTAGTA CTA 11: 99,224,352 (GRCm39) probably benign Het
Lrriq4 C A 3: 30,713,242 (GRCm39) Q448K probably benign Het
Ly6g5c A G 17: 35,330,863 (GRCm39) I128M possibly damaging Het
Mroh9 T A 1: 162,903,860 (GRCm39) S51C probably damaging Het
Myh3 A G 11: 66,970,828 (GRCm39) S2G probably benign Het
Nat8f4 A G 6: 85,878,497 (GRCm39) Y9H probably damaging Het
Negr1 T C 3: 156,267,836 (GRCm39) V2A probably benign Het
Or2y1 C T 11: 49,386,131 (GRCm39) T257I probably damaging Het
Or7g19 C T 9: 18,856,781 (GRCm39) T279I probably benign Het
Or8k32 T G 2: 86,368,857 (GRCm39) Y132S probably damaging Het
Otog G A 7: 45,895,707 (GRCm39) C107Y probably damaging Het
Pdgfra C A 5: 75,324,394 (GRCm39) T83K probably benign Het
Retreg1 A G 15: 25,969,924 (GRCm39) D109G probably damaging Het
Rgs12 T A 5: 35,189,613 (GRCm39) W674R probably damaging Het
Rgs18 T C 1: 144,631,818 (GRCm39) D98G possibly damaging Het
Rnf146 A G 10: 29,223,715 (GRCm39) F57S probably damaging Het
Skic3 T A 13: 76,282,889 (GRCm39) V737D probably damaging Het
Slc22a20 C A 19: 6,021,464 (GRCm39) V513L probably benign Het
Stox2 G T 8: 47,646,661 (GRCm39) F266L probably damaging Het
Tbx21 C T 11: 96,990,863 (GRCm39) V272M probably damaging Het
Tmc7 A G 7: 118,144,850 (GRCm39) F570S probably benign Het
Tmem236 T C 2: 14,224,117 (GRCm39) I302T probably damaging Het
Tns2 C T 15: 102,017,369 (GRCm39) R281C probably damaging Het
Trpm3 T C 19: 22,862,776 (GRCm39) L506S probably damaging Het
Uggt1 T C 1: 36,218,694 (GRCm39) I78V probably damaging Het
Xpo4 A T 14: 57,828,328 (GRCm39) V844D probably damaging Het
Zfp507 C T 7: 35,493,150 (GRCm39) R631Q probably damaging Het
Other mutations in Pdlim2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02295:Pdlim2 APN 14 70,403,532 (GRCm39) splice site probably benign
IGL02338:Pdlim2 APN 14 70,411,906 (GRCm39) missense probably damaging 1.00
IGL03286:Pdlim2 APN 14 70,411,925 (GRCm39) missense possibly damaging 0.88
PIT4504001:Pdlim2 UTSW 14 70,403,579 (GRCm39) missense probably benign 0.44
R0751:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R0768:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R0832:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R1167:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R1207:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R1207:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R1343:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R1412:Pdlim2 UTSW 14 70,411,773 (GRCm39) splice site probably benign
R1595:Pdlim2 UTSW 14 70,402,193 (GRCm39) missense probably damaging 1.00
R1689:Pdlim2 UTSW 14 70,408,688 (GRCm39) missense probably damaging 0.98
R1703:Pdlim2 UTSW 14 70,411,784 (GRCm39) critical splice donor site probably null
R1843:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R1845:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R1924:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R1925:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R2004:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R2005:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R2202:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R2205:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R2237:Pdlim2 UTSW 14 70,408,698 (GRCm39) missense probably benign 0.05
R2843:Pdlim2 UTSW 14 70,403,549 (GRCm39) missense probably benign 0.02
R4042:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R4965:Pdlim2 UTSW 14 70,405,464 (GRCm39) unclassified probably benign
R4971:Pdlim2 UTSW 14 70,405,208 (GRCm39) missense probably damaging 1.00
R5951:Pdlim2 UTSW 14 70,405,229 (GRCm39) missense probably benign 0.06
R6252:Pdlim2 UTSW 14 70,405,137 (GRCm39) missense probably damaging 1.00
R7208:Pdlim2 UTSW 14 70,411,826 (GRCm39) missense probably damaging 1.00
R7597:Pdlim2 UTSW 14 70,403,645 (GRCm39) missense possibly damaging 0.58
R7627:Pdlim2 UTSW 14 70,408,924 (GRCm39) missense probably benign
R8342:Pdlim2 UTSW 14 70,403,563 (GRCm39) missense probably damaging 1.00
R8554:Pdlim2 UTSW 14 70,408,698 (GRCm39) missense probably benign
R9361:Pdlim2 UTSW 14 70,402,190 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTCTCAGTATAATCATGTCTGC -3'
(R):5'- TGGGGTTGGTAAAATGAAATTCCTG -3'

Sequencing Primer
(F):5'- AATCATGTCTGCAGAGTCTGAG -3'
(R):5'- AAATTCCTGAGAGAGAGGCTTTTG -3'
Posted On 2014-07-14