Mutagenetix > Incidental Mutation

Incidental Mutation 'R1924:Adamts13'

213255

Institutional Source

Beutler Lab

Gene Symbol

Adamts13

Ensembl Gene

ENSMUSG00000014852

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 13

Synonyms

vWF-CP mRNA for von Willebrand factor-cleaving, LOC279028

MMRRC Submission

039942-MU

Accession Numbers

NCBI RefSeq: NM_001001322.2; MGI:2685556

Essential gene?

Probably non essential (E-score: 0.068) question?

Stock #

R1924 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

26973416-27009628 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 26984141 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Leucine at position 434 (Q434L)

Ref Sequence

ENSEMBL: ENSMUSP00000099955 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000014996] [ENSMUST00000102891]

AlphaFold

Q769J6

Predicted Effect

probably damaging
Transcript: ENSMUST00000014996
AA Change: Q434L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000014996
Gene: ENSMUSG00000014852
AA Change: Q434L

Domain	Start	End	E-Value	Type
transmembrane domain	13	35	N/A	INTRINSIC
Pfam:Reprolysin_4	84	287	2.3e-11	PFAM
Pfam:Reprolysin	84	291	1e-15	PFAM
Pfam:Reprolysin_3	113	237	2e-10	PFAM
Pfam:Reprolysin_2	132	281	5e-9	PFAM
TSP1	392	444	3.29e-14	SMART
TSP1	693	748	7.01e0	SMART
TSP1	750	810	3.34e-6	SMART
TSP1	904	959	5.85e0	SMART
TSP1	961	1019	2.69e0	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000102891
AA Change: Q434L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000099955
Gene: ENSMUSG00000014852
AA Change: Q434L

Domain	Start	End	E-Value	Type
transmembrane domain	13	35	N/A	INTRINSIC
Pfam:Reprolysin_4	84	287	8.5e-11	PFAM
Pfam:Reprolysin	96	291	4.9e-14	PFAM
Pfam:Reprolysin_3	106	237	5.6e-11	PFAM
TSP1	392	444	3.29e-14	SMART
TSP1	693	748	7.01e0	SMART
TSP1	750	810	3.34e-6	SMART
TSP1	904	959	5.85e0	SMART
TSP1	961	1019	2.69e0	SMART
Blast:TSP1	1022	1079	4e-26	BLAST
TSP1	1081	1137	4.58e-4	SMART
Blast:CUB	1196	1293	2e-39	BLAST
Blast:CUB	1303	1412	3e-63	BLAST

Meta Mutation Damage Score

0.4588

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.4%
20x: 92.9%

Validation Efficiency

94% (63/67)

MGI Phenotype

FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. In certain mouse strains (C57BL/6, for example) an intracisternal A-type particle (IAP) retrotransposon sequence is located in the intron 23 that causes an alternate splicing event resulting in a shorter transcript variants encoding shorter isoforms. The encoded preproprotein undergoes proteolytic processing to generate an active enzyme that cleaves von Willebrand factor (VWF) in circulating blood. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous mutation of this gene results in thrombocytopenia, decreased survival, and increased susceptibility to developing thrombotic thrombocytopenic purpura after shiga toxin injection. On a different background, mutants are viable and fertile. [provided by MGI curators]

Allele List at MGI

All alleles(10) : Targeted(7) Gene trapped(2) Spontaneous(1)

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acacb	G	A	5: 114,230,720	M1666I	possibly damaging	Het
Adgrg3	G	A	8: 95,035,934	R204H	probably benign	Het
Arhgef28	A	C	13: 97,936,816		probably benign	Het
AU041133	T	A	10: 82,151,267	C251*	probably null	Het
Axin2	T	A	11: 108,942,968	N580K	probably benign	Het
C4b	A	G	17: 34,729,657	C1560R	probably damaging	Het
C530008M17Rik	A	T	5: 76,858,623	T944S	unknown	Het
Cacna1g	A	G	11: 94,444,054	I809T	possibly damaging	Het
Cacna1s	C	A	1: 136,089,017		probably null	Het
Cadps2	T	C	6: 23,688,858	S151G	probably damaging	Het
Capn1	T	C	19: 5,990,056		probably null	Het
Capn9	A	G	8: 124,576,226	S28G	probably benign	Het
Ccdc73	A	G	2: 104,992,292	D862G	probably damaging	Het
Cdk17	T	C	10: 93,226,117	L237P	probably damaging	Het
Chad	A	C	11: 94,565,558	N154T	possibly damaging	Het
Cog1	C	T	11: 113,656,212	T544I	probably benign	Het
Ctnna2	T	C	6: 76,954,847	E590G	possibly damaging	Het
Dapk2	T	A	9: 66,165,360	M6K	probably benign	Het
Dchs1	T	C	7: 105,772,280	E311G	possibly damaging	Het
Ddr2	T	A	1: 169,982,072	T779S	probably benign	Het
Dhtkd1	A	G	2: 5,911,933	V644A	probably damaging	Het
Dock2	A	G	11: 34,464,934	V147A	possibly damaging	Het
Ear10	A	T	14: 43,922,900	*157K	probably null	Het
Gm10801	T	C	2: 98,663,852	I113T	probably damaging	Het
Gmps	T	G	3: 63,998,628	C449G	probably damaging	Het
Grin3a	A	G	4: 49,844,988	S32P	possibly damaging	Het
Igkv1-115	A	T	6: 68,161,608	D65V	probably damaging	Het
Klk1b4	A	G	7: 44,209,681	N41S	probably benign	Het
Krt26	CTAGTA	CTA	11: 99,333,526		probably benign	Het
Lrrc8a	T	A	2: 30,255,250	D25E	probably damaging	Het
Muc5b	A	G	7: 141,868,223	R4426G	possibly damaging	Het
Muc6	G	A	7: 141,638,400	S2120F	possibly damaging	Het
Myo5a	G	T	9: 75,116,207	D17Y	probably damaging	Het
Nat1	C	G	8: 67,491,424	L154V	probably benign	Het
Nek3	T	A	8: 22,157,031	T163S	probably damaging	Het
Olfr12	T	C	1: 92,620,803	L299P	probably damaging	Het
Olfr225	G	T	11: 59,613,123	R53L	possibly damaging	Het
Olfr508	A	G	7: 108,630,355	D121G	probably damaging	Het
Olfr773	A	G	10: 129,187,175	I82T	possibly damaging	Het
Olfr926	T	A	9: 38,877,851	I225N	probably damaging	Het
Olfr951	A	T	9: 39,393,867	E22D	possibly damaging	Het
Osr1	T	G	12: 9,579,268	L47R	probably damaging	Het
Pdlim2	C	T	14: 70,164,779	R296H	probably damaging	Het
Pik3ap1	T	A	19: 41,302,614	N493I	possibly damaging	Het
Polr3e	T	A	7: 120,940,597	N522K	probably damaging	Het
Rabgap1	T	A	2: 37,495,759		probably null	Het
Rp1l1	C	A	14: 64,031,543	A1526E	probably benign	Het
Scn3a	T	A	2: 65,461,534	I1623F	probably damaging	Het
Serpinb9e	A	G	13: 33,253,445	T104A	probably benign	Het
Sh3rf3	T	C	10: 59,104,167		probably benign	Het
Slc30a3	A	G	5: 31,088,404	Y213H	probably damaging	Het
Sptbn4	C	T	7: 27,407,138	R955H	probably damaging	Het
Tfb1m	A	T	17: 3,519,671	Y307N	probably damaging	Het
Tnrc6b	G	T	15: 80,884,206		probably null	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Ulk1	A	G	5: 110,791,070	Y501H	probably damaging	Het
Wdr66	A	G	5: 123,302,739	I1120V	possibly damaging	Het
Zbtb17	A	G	4: 141,464,603	H315R	probably damaging	Het
Zeb2	A	G	2: 45,002,612	Y142H	probably damaging	Het
Zfr	T	C	15: 12,160,629	S763P	possibly damaging	Het

Other mutations in Adamts13

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Adamts13	APN	2	27005361	missense	probably benign	0.04
IGL00465:Adamts13	APN	2	26973555	missense	probably benign	0.32
IGL01114:Adamts13	APN	2	27005190	missense	probably benign	0.41
IGL01138:Adamts13	APN	2	26983042	missense	probably damaging	1.00
IGL01154:Adamts13	APN	2	27006194	missense	probably benign
IGL01860:Adamts13	APN	2	26978011	missense	probably damaging	0.99
IGL01924:Adamts13	APN	2	26996583	missense	possibly damaging	0.80
IGL01991:Adamts13	APN	2	26990598	missense	probably damaging	0.97
IGL02215:Adamts13	APN	2	26985483	missense	probably damaging	1.00
IGL02415:Adamts13	APN	2	26989283	missense	possibly damaging	0.95
IGL02519:Adamts13	APN	2	26978675	missense	probably damaging	1.00
IGL02956:Adamts13	APN	2	26983037	missense	probably benign	0.18
IGL03209:Adamts13	APN	2	26992961	missense	probably benign	0.00
I1329:Adamts13	UTSW	2	26973619	missense	possibly damaging	0.52
IGL02837:Adamts13	UTSW	2	26991420	missense	probably benign	0.01
IGL03048:Adamts13	UTSW	2	26978699	critical splice donor site	probably null
R0041:Adamts13	UTSW	2	26983974	missense	probably damaging	1.00
R0217:Adamts13	UTSW	2	26996921	splice site	probably benign
R0276:Adamts13	UTSW	2	26975760	missense	possibly damaging	0.91
R0309:Adamts13	UTSW	2	26986989	missense	probably damaging	0.99
R0348:Adamts13	UTSW	2	26981080	missense	probably benign	0.13
R0369:Adamts13	UTSW	2	27005186	missense	probably benign	0.00
R0386:Adamts13	UTSW	2	26986679	splice site	probably null
R0553:Adamts13	UTSW	2	26991334	nonsense	probably null
R0714:Adamts13	UTSW	2	26986985	splice site	probably benign
R0862:Adamts13	UTSW	2	27006324	critical splice donor site	probably null
R1320:Adamts13	UTSW	2	26989246	missense	probably damaging	0.97
R1458:Adamts13	UTSW	2	26988354	missense	probably damaging	1.00
R1473:Adamts13	UTSW	2	26981753	nonsense	probably null
R1491:Adamts13	UTSW	2	26978315	missense	probably damaging	1.00
R1588:Adamts13	UTSW	2	26975675	missense	probably benign	0.01
R1638:Adamts13	UTSW	2	26996583	missense	possibly damaging	0.80
R1724:Adamts13	UTSW	2	26991294	missense	probably benign	0.00
R2001:Adamts13	UTSW	2	26973990	missense	probably benign
R2072:Adamts13	UTSW	2	27005425	missense	probably benign	0.10
R2073:Adamts13	UTSW	2	27006314	missense	probably damaging	1.00
R2409:Adamts13	UTSW	2	26978362	missense	probably benign	0.00
R4362:Adamts13	UTSW	2	27004782	missense	probably damaging	1.00
R4363:Adamts13	UTSW	2	27004782	missense	probably damaging	1.00
R4422:Adamts13	UTSW	2	27005400	missense	probably benign	0.00
R4769:Adamts13	UTSW	2	27008711	nonsense	probably null
R4785:Adamts13	UTSW	2	26983042	missense	probably damaging	1.00
R4831:Adamts13	UTSW	2	26983130	critical splice donor site	probably null
R4832:Adamts13	UTSW	2	26989402	missense	probably benign	0.22
R4945:Adamts13	UTSW	2	26986610	missense	probably damaging	1.00
R5047:Adamts13	UTSW	2	26996910	missense	probably damaging	0.98
R5126:Adamts13	UTSW	2	26996915	critical splice donor site	probably null
R5161:Adamts13	UTSW	2	26993008	missense	probably benign	0.00
R5394:Adamts13	UTSW	2	26986558	missense	probably benign	0.00
R5557:Adamts13	UTSW	2	26973639	missense	probably benign	0.05
R5660:Adamts13	UTSW	2	26996749	missense	probably benign
R5890:Adamts13	UTSW	2	26986591	missense	probably damaging	0.96
R6168:Adamts13	UTSW	2	27004886	missense	probably benign	0.37
R6536:Adamts13	UTSW	2	26975750	missense	probably damaging	0.99
R6929:Adamts13	UTSW	2	27006263	nonsense	probably null
R7207:Adamts13	UTSW	2	26978695	missense	probably damaging	1.00
R7211:Adamts13	UTSW	2	26989298	missense	probably benign	0.40
R7212:Adamts13	UTSW	2	27006314	missense	probably damaging	1.00
R7392:Adamts13	UTSW	2	26989324	missense	probably damaging	1.00
R7583:Adamts13	UTSW	2	26973953	missense	probably benign
R7604:Adamts13	UTSW	2	27005206	missense	probably benign	0.00
R7783:Adamts13	UTSW	2	26990585	missense	not run
R7814:Adamts13	UTSW	2	26996549	missense	probably benign
R8076:Adamts13	UTSW	2	26990612	missense	probably benign	0.06
R8245:Adamts13	UTSW	2	26990556	missense	probably damaging	1.00
R8526:Adamts13	UTSW	2	26978000	missense	probably benign
R9112:Adamts13	UTSW	2	26990367	missense	possibly damaging	0.60
R9147:Adamts13	UTSW	2	26993012	missense	probably benign
R9148:Adamts13	UTSW	2	26993012	missense	probably benign
R9704:Adamts13	UTSW	2	27005225	missense
R9743:Adamts13	UTSW	2	26996800	missense	probably benign	0.16
R9743:Adamts13	UTSW	2	27005479	critical splice donor site	probably null
X0027:Adamts13	UTSW	2	26985546	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TGGACACTGGTCTAGCTGG -3'
(R):5'- TCACATCAGTGTCTAAATGAAACAC -3'

Sequencing Primer
(F):5'- TGCTCCCGATCCTGTGGAG -3'
(R):5'- GAAACACTTTTCACTGTGTACCC -3'

Posted On

2014-07-14