Incidental Mutation 'R1924:Polr3e'
ID213279
Institutional Source Beutler Lab
Gene Symbol Polr3e
Ensembl Gene ENSMUSG00000030880
Gene Namepolymerase (RNA) III (DNA directed) polypeptide E
SynonymsSin, RPC5
MMRRC Submission 039942-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #R1924 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location120917744-120947432 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 120940597 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 522 (N522K)
Ref Sequence ENSEMBL: ENSMUSP00000146970 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033173] [ENSMUST00000106483] [ENSMUST00000207481]
Predicted Effect probably damaging
Transcript: ENSMUST00000033173
AA Change: N548K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033173
Gene: ENSMUSG00000030880
AA Change: N548K

DomainStartEndE-ValueType
Pfam:Sin_N 5 432 7.1e-161 PFAM
coiled coil region 458 491 N/A INTRINSIC
low complexity region 504 518 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106483
AA Change: N548K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102092
Gene: ENSMUSG00000030880
AA Change: N548K

DomainStartEndE-ValueType
Pfam:Sin_N 4 29 2.8e-10 PFAM
Pfam:Sin_N 29 408 6.9e-141 PFAM
coiled coil region 432 465 N/A INTRINSIC
low complexity region 478 492 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000207481
AA Change: N522K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209014
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.9%
Validation Efficiency 94% (63/67)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb G A 5: 114,230,720 M1666I possibly damaging Het
Adamts13 A T 2: 26,984,141 Q434L probably damaging Het
Adgrg3 G A 8: 95,035,934 R204H probably benign Het
Arhgef28 A C 13: 97,936,816 probably benign Het
AU041133 T A 10: 82,151,267 C251* probably null Het
Axin2 T A 11: 108,942,968 N580K probably benign Het
C4b A G 17: 34,729,657 C1560R probably damaging Het
C530008M17Rik A T 5: 76,858,623 T944S unknown Het
Cacna1g A G 11: 94,444,054 I809T possibly damaging Het
Cacna1s C A 1: 136,089,017 probably null Het
Cadps2 T C 6: 23,688,858 S151G probably damaging Het
Capn1 T C 19: 5,990,056 probably null Het
Capn9 A G 8: 124,576,226 S28G probably benign Het
Ccdc73 A G 2: 104,992,292 D862G probably damaging Het
Cdk17 T C 10: 93,226,117 L237P probably damaging Het
Chad A C 11: 94,565,558 N154T possibly damaging Het
Cog1 C T 11: 113,656,212 T544I probably benign Het
Ctnna2 T C 6: 76,954,847 E590G possibly damaging Het
Dapk2 T A 9: 66,165,360 M6K probably benign Het
Dchs1 T C 7: 105,772,280 E311G possibly damaging Het
Ddr2 T A 1: 169,982,072 T779S probably benign Het
Dhtkd1 A G 2: 5,911,933 V644A probably damaging Het
Dock2 A G 11: 34,464,934 V147A possibly damaging Het
Ear10 A T 14: 43,922,900 *157K probably null Het
Gm10801 T C 2: 98,663,852 I113T probably damaging Het
Gmps T G 3: 63,998,628 C449G probably damaging Het
Grin3a A G 4: 49,844,988 S32P possibly damaging Het
Igkv1-115 A T 6: 68,161,608 D65V probably damaging Het
Klk1b4 A G 7: 44,209,681 N41S probably benign Het
Krt26 CTAGTA CTA 11: 99,333,526 probably benign Het
Lrrc8a T A 2: 30,255,250 D25E probably damaging Het
Muc5b A G 7: 141,868,223 R4426G possibly damaging Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Myo5a G T 9: 75,116,207 D17Y probably damaging Het
Nat1 C G 8: 67,491,424 L154V probably benign Het
Nek3 T A 8: 22,157,031 T163S probably damaging Het
Olfr12 T C 1: 92,620,803 L299P probably damaging Het
Olfr225 G T 11: 59,613,123 R53L possibly damaging Het
Olfr508 A G 7: 108,630,355 D121G probably damaging Het
Olfr773 A G 10: 129,187,175 I82T possibly damaging Het
Olfr926 T A 9: 38,877,851 I225N probably damaging Het
Olfr951 A T 9: 39,393,867 E22D possibly damaging Het
Osr1 T G 12: 9,579,268 L47R probably damaging Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Pik3ap1 T A 19: 41,302,614 N493I possibly damaging Het
Rabgap1 T A 2: 37,495,759 probably null Het
Rp1l1 C A 14: 64,031,543 A1526E probably benign Het
Scn3a T A 2: 65,461,534 I1623F probably damaging Het
Serpinb9e A G 13: 33,253,445 T104A probably benign Het
Sh3rf3 T C 10: 59,104,167 probably benign Het
Slc30a3 A G 5: 31,088,404 Y213H probably damaging Het
Sptbn4 C T 7: 27,407,138 R955H probably damaging Het
Tfb1m A T 17: 3,519,671 Y307N probably damaging Het
Tnrc6b G T 15: 80,884,206 probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Ulk1 A G 5: 110,791,070 Y501H probably damaging Het
Wdr66 A G 5: 123,302,739 I1120V possibly damaging Het
Zbtb17 A G 4: 141,464,603 H315R probably damaging Het
Zeb2 A G 2: 45,002,612 Y142H probably damaging Het
Zfr T C 15: 12,160,629 S763P possibly damaging Het
Other mutations in Polr3e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Polr3e APN 7 120940811 nonsense probably null
IGL01664:Polr3e APN 7 120931317 splice site probably benign
IGL01980:Polr3e APN 7 120940296 splice site probably benign
IGL02027:Polr3e APN 7 120930963 missense probably damaging 1.00
IGL02208:Polr3e APN 7 120932140 missense probably damaging 0.99
IGL02549:Polr3e APN 7 120939759 missense probably damaging 1.00
IGL03338:Polr3e APN 7 120937620 missense probably benign 0.06
R1192:Polr3e UTSW 7 120933308 missense probably benign 0.03
R1328:Polr3e UTSW 7 120933823 splice site probably benign
R1435:Polr3e UTSW 7 120940788 missense probably benign 0.16
R1528:Polr3e UTSW 7 120940597 missense probably damaging 1.00
R1754:Polr3e UTSW 7 120939298 critical splice donor site probably null
R2169:Polr3e UTSW 7 120932137 missense probably damaging 1.00
R2201:Polr3e UTSW 7 120932242 missense probably benign
R2362:Polr3e UTSW 7 120942564 missense probably damaging 1.00
R2696:Polr3e UTSW 7 120933377 missense probably damaging 1.00
R4416:Polr3e UTSW 7 120939057 critical splice donor site probably null
R5278:Polr3e UTSW 7 120922961 missense possibly damaging 0.67
R5560:Polr3e UTSW 7 120922949 missense possibly damaging 0.83
R5689:Polr3e UTSW 7 120940689 missense possibly damaging 0.82
R5790:Polr3e UTSW 7 120927967 missense probably damaging 1.00
R6242:Polr3e UTSW 7 120940467 missense possibly damaging 0.62
R6317:Polr3e UTSW 7 120927982 missense possibly damaging 0.49
R6334:Polr3e UTSW 7 120927999 missense possibly damaging 0.87
R6891:Polr3e UTSW 7 120944650 missense probably damaging 0.98
R7110:Polr3e UTSW 7 120940287 splice site probably null
R7771:Polr3e UTSW 7 120940578 missense probably benign
R7809:Polr3e UTSW 7 120924226 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCAGAACCATGCCTTCTTG -3'
(R):5'- GACGCCACTGAAGAGTATATGG -3'

Sequencing Primer
(F):5'- CATGCCTTCTTGGAGCGTGAAC -3'
(R):5'- CCACTGAAGAGTATATGGCCCGG -3'
Posted On2014-07-14