Mutagenetix > Incidental Mutation

Incidental Mutation 'R1924:Myo5a'

213288

Institutional Source

Beutler Lab

Gene Symbol

Myo5a

Ensembl Gene

ENSMUSG00000034593

Gene Name

myosin VA

Synonyms

9630007J19Rik, Dbv, flail, MVa, Myo5, MyoVA

MMRRC Submission

039942-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.953) question?

Stock #

R1924 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

75071015-75223688 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 75116207 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Tyrosine at position 17 (D17Y)

Ref Sequence

ENSEMBL: ENSMUSP00000117493 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000123128] [ENSMUST00000123531] [ENSMUST00000136731] [ENSMUST00000155282]

AlphaFold

Q99104

Predicted Effect

probably damaging
Transcript: ENSMUST00000123128
AA Change: D17Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000116028
Gene: ENSMUSG00000034593
AA Change: D17Y

Domain	Start	End	E-Value	Type
MYSc	63	764	N/A	SMART
IQ	765	787	3.65e-4	SMART
IQ	788	810	1.56e-3	SMART
IQ	813	835	3.05e-6	SMART
IQ	836	858	8.38e-4	SMART
IQ	861	883	1.09e-2	SMART
IQ	884	906	6.97e0	SMART
coiled coil region	1153	1234	N/A	INTRINSIC
coiled coil region	1314	1364	N/A	INTRINSIC
coiled coil region	1406	1443	N/A	INTRINSIC
DIL	1685	1790	2.47e-51	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000123531
AA Change: D17Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000136731
AA Change: D17Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000120444
Gene: ENSMUSG00000034593
AA Change: D17Y

Domain	Start	End	E-Value	Type
MYSc	63	764	N/A	SMART
IQ	765	787	3.65e-4	SMART
IQ	788	810	1.56e-3	SMART
IQ	813	835	3.05e-6	SMART
IQ	836	858	8.38e-4	SMART
IQ	861	883	1.09e-2	SMART
IQ	884	906	6.97e0	SMART
coiled coil region	1153	1234	N/A	INTRINSIC
coiled coil region	1314	1418	N/A	INTRINSIC
DIL	1660	1765	2.47e-51	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136871

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149823

Predicted Effect

probably damaging
Transcript: ENSMUST00000155282
AA Change: D17Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000117493
Gene: ENSMUSG00000034593
AA Change: D17Y

Domain	Start	End	E-Value	Type
MYSc	63	764	N/A	SMART
IQ	765	787	3.65e-4	SMART
IQ	788	810	1.56e-3	SMART
IQ	813	835	3.05e-6	SMART
IQ	836	858	8.38e-4	SMART
IQ	861	883	1.09e-2	SMART
IQ	884	906	6.97e0	SMART
coiled coil region	1153	1234	N/A	INTRINSIC
coiled coil region	1339	1445	N/A	INTRINSIC
DIL	1687	1792	2.47e-51	SMART

Meta Mutation Damage Score

0.2921

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.4%
20x: 92.9%

Validation Efficiency

94% (63/67)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of three myosin V heavy-chain genes, belonging to the myosin gene superfamily. Myosin V is a class of actin-based motor proteins involved in cytoplasmic vesicle transport and anchorage, spindle-pole alignment and mRNA translocation. The protein encoded by this gene is abundant in melanocytes and nerve cells. Mutations in this gene cause Griscelli syndrome type-1 (GS1), Griscelli syndrome type-3 (GS3) and neuroectodermal melanolysosomal disease, or Elejalde disease. Multiple alternatively spliced transcript variants encoding different isoforms have been reported, but the full-length nature of some variants has not been determined. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mutations in this gene result in diluted coat color, behavioral deficits including opisthotonus, and postnatal or premature death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acacb	G	A	5: 114,230,720	M1666I	possibly damaging	Het
Adamts13	A	T	2: 26,984,141	Q434L	probably damaging	Het
Adgrg3	G	A	8: 95,035,934	R204H	probably benign	Het
Arhgef28	A	C	13: 97,936,816		probably benign	Het
AU041133	T	A	10: 82,151,267	C251*	probably null	Het
Axin2	T	A	11: 108,942,968	N580K	probably benign	Het
C4b	A	G	17: 34,729,657	C1560R	probably damaging	Het
C530008M17Rik	A	T	5: 76,858,623	T944S	unknown	Het
Cacna1g	A	G	11: 94,444,054	I809T	possibly damaging	Het
Cacna1s	C	A	1: 136,089,017		probably null	Het
Cadps2	T	C	6: 23,688,858	S151G	probably damaging	Het
Capn1	T	C	19: 5,990,056		probably null	Het
Capn9	A	G	8: 124,576,226	S28G	probably benign	Het
Ccdc73	A	G	2: 104,992,292	D862G	probably damaging	Het
Cdk17	T	C	10: 93,226,117	L237P	probably damaging	Het
Chad	A	C	11: 94,565,558	N154T	possibly damaging	Het
Cog1	C	T	11: 113,656,212	T544I	probably benign	Het
Ctnna2	T	C	6: 76,954,847	E590G	possibly damaging	Het
Dapk2	T	A	9: 66,165,360	M6K	probably benign	Het
Dchs1	T	C	7: 105,772,280	E311G	possibly damaging	Het
Ddr2	T	A	1: 169,982,072	T779S	probably benign	Het
Dhtkd1	A	G	2: 5,911,933	V644A	probably damaging	Het
Dock2	A	G	11: 34,464,934	V147A	possibly damaging	Het
Ear10	A	T	14: 43,922,900	*157K	probably null	Het
Gm10801	T	C	2: 98,663,852	I113T	probably damaging	Het
Gmps	T	G	3: 63,998,628	C449G	probably damaging	Het
Grin3a	A	G	4: 49,844,988	S32P	possibly damaging	Het
Igkv1-115	A	T	6: 68,161,608	D65V	probably damaging	Het
Klk1b4	A	G	7: 44,209,681	N41S	probably benign	Het
Krt26	CTAGTA	CTA	11: 99,333,526		probably benign	Het
Lrrc8a	T	A	2: 30,255,250	D25E	probably damaging	Het
Muc5b	A	G	7: 141,868,223	R4426G	possibly damaging	Het
Muc6	G	A	7: 141,638,400	S2120F	possibly damaging	Het
Nat1	C	G	8: 67,491,424	L154V	probably benign	Het
Nek3	T	A	8: 22,157,031	T163S	probably damaging	Het
Olfr12	T	C	1: 92,620,803	L299P	probably damaging	Het
Olfr225	G	T	11: 59,613,123	R53L	possibly damaging	Het
Olfr508	A	G	7: 108,630,355	D121G	probably damaging	Het
Olfr773	A	G	10: 129,187,175	I82T	possibly damaging	Het
Olfr926	T	A	9: 38,877,851	I225N	probably damaging	Het
Olfr951	A	T	9: 39,393,867	E22D	possibly damaging	Het
Osr1	T	G	12: 9,579,268	L47R	probably damaging	Het
Pdlim2	C	T	14: 70,164,779	R296H	probably damaging	Het
Pik3ap1	T	A	19: 41,302,614	N493I	possibly damaging	Het
Polr3e	T	A	7: 120,940,597	N522K	probably damaging	Het
Rabgap1	T	A	2: 37,495,759		probably null	Het
Rp1l1	C	A	14: 64,031,543	A1526E	probably benign	Het
Scn3a	T	A	2: 65,461,534	I1623F	probably damaging	Het
Serpinb9e	A	G	13: 33,253,445	T104A	probably benign	Het
Sh3rf3	T	C	10: 59,104,167		probably benign	Het
Slc30a3	A	G	5: 31,088,404	Y213H	probably damaging	Het
Sptbn4	C	T	7: 27,407,138	R955H	probably damaging	Het
Tfb1m	A	T	17: 3,519,671	Y307N	probably damaging	Het
Tnrc6b	G	T	15: 80,884,206		probably null	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Ulk1	A	G	5: 110,791,070	Y501H	probably damaging	Het
Wdr66	A	G	5: 123,302,739	I1120V	possibly damaging	Het
Zbtb17	A	G	4: 141,464,603	H315R	probably damaging	Het
Zeb2	A	G	2: 45,002,612	Y142H	probably damaging	Het
Zfr	T	C	15: 12,160,629	S763P	possibly damaging	Het

Other mutations in Myo5a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Myo5a	APN	9	75161497	nonsense	probably null
IGL00547:Myo5a	APN	9	75141453	missense	probably benign	0.00
IGL00788:Myo5a	APN	9	75168959	missense	probably benign	0.15
IGL01327:Myo5a	APN	9	75187538	splice site	probably benign
IGL01687:Myo5a	APN	9	75156249	missense	probably benign	0.12
IGL01886:Myo5a	APN	9	75169090	splice site	probably benign
IGL01945:Myo5a	APN	9	75140671	missense	probably damaging	1.00
IGL02127:Myo5a	APN	9	75212981	missense	probably benign	0.12
IGL02137:Myo5a	APN	9	75161535	splice site	probably null
IGL02183:Myo5a	APN	9	75167236	splice site	probably benign
IGL02427:Myo5a	APN	9	75176618	splice site	probably benign
IGL02490:Myo5a	APN	9	75136455	missense	probably damaging	1.00
IGL02574:Myo5a	APN	9	75211147	missense	probably benign	0.00
IGL02886:Myo5a	APN	9	75151887	splice site	probably benign
IGL02961:Myo5a	APN	9	75215120	missense	probably benign	0.04
IGL03090:Myo5a	APN	9	75120833	missense	probably damaging	1.00
IGL03119:Myo5a	APN	9	75174015	missense	probably benign	0.01
IGL03237:Myo5a	APN	9	75129994	missense	probably damaging	1.00
IGL03296:Myo5a	APN	9	75116202	missense	probably damaging	1.00
naoki	UTSW	9	75161492	missense	probably damaging	1.00
new_gray	UTSW	9		missense
nut	UTSW	9		splice donor site
silver_decerebrate	UTSW	9	75164195	missense	probably damaging	1.00
silver_decerebrate_2	UTSW	9	75211126	missense	probably damaging	1.00
IGL02988:Myo5a	UTSW	9	75130141	splice site	probably benign
IGL03050:Myo5a	UTSW	9	75146909	splice site	probably null
PIT4403001:Myo5a	UTSW	9	75217523	missense	probably damaging	1.00
R0047:Myo5a	UTSW	9	75156207	missense	probably damaging	1.00
R0047:Myo5a	UTSW	9	75156207	missense	probably damaging	1.00
R0091:Myo5a	UTSW	9	75161492	missense	probably damaging	1.00
R0142:Myo5a	UTSW	9	75160574	missense	probably benign	0.01
R0243:Myo5a	UTSW	9	75186123	critical splice donor site	probably null
R0395:Myo5a	UTSW	9	75193977	missense	probably benign	0.39
R0427:Myo5a	UTSW	9	75174196	missense	probably benign	0.00
R0545:Myo5a	UTSW	9	75167037	missense	possibly damaging	0.94
R0565:Myo5a	UTSW	9	75180112	missense	probably benign	0.00
R0601:Myo5a	UTSW	9	75174015	missense	probably benign	0.01
R1457:Myo5a	UTSW	9	75213065	missense	probably damaging	0.99
R1510:Myo5a	UTSW	9	75171551	missense	probably benign
R1548:Myo5a	UTSW	9	75171746	missense	probably damaging	1.00
R1759:Myo5a	UTSW	9	75181993	missense	possibly damaging	0.72
R1960:Myo5a	UTSW	9	75147857	missense	probably damaging	1.00
R2050:Myo5a	UTSW	9	75146874	missense	probably benign	0.01
R2070:Myo5a	UTSW	9	75181984	missense	probably benign	0.03
R2075:Myo5a	UTSW	9	75189918	missense	probably benign	0.01
R2148:Myo5a	UTSW	9	75180147	missense	probably damaging	1.00
R2201:Myo5a	UTSW	9	75217943	missense	possibly damaging	0.51
R2337:Myo5a	UTSW	9	75203801	missense	probably damaging	1.00
R2357:Myo5a	UTSW	9	75201365	missense	probably damaging	0.99
R2392:Myo5a	UTSW	9	75209239	missense	probably benign	0.02
R2432:Myo5a	UTSW	9	75212873	missense	possibly damaging	0.89
R2568:Myo5a	UTSW	9	75123040	missense	probably damaging	1.00
R2568:Myo5a	UTSW	9	75151897	missense	probably damaging	1.00
R2932:Myo5a	UTSW	9	75196136	missense	possibly damaging	0.85
R2971:Myo5a	UTSW	9	75116202	missense	probably damaging	1.00
R4231:Myo5a	UTSW	9	75189997	missense	possibly damaging	0.67
R4293:Myo5a	UTSW	9	75144171	missense	probably benign
R4321:Myo5a	UTSW	9	75217530	missense	probably damaging	0.99
R4450:Myo5a	UTSW	9	75167176	missense	probably benign	0.00
R4573:Myo5a	UTSW	9	75201297	splice site	probably null
R4577:Myo5a	UTSW	9	75217545	missense	probably damaging	1.00
R4601:Myo5a	UTSW	9	75136388	missense	probably damaging	1.00
R4690:Myo5a	UTSW	9	75153823	missense	probably damaging	0.99
R4691:Myo5a	UTSW	9	75180156	missense	probably damaging	0.99
R4764:Myo5a	UTSW	9	75116336	intron	probably benign
R4767:Myo5a	UTSW	9	75144076	missense	probably damaging	0.99
R4811:Myo5a	UTSW	9	75141543	critical splice donor site	probably null
R4829:Myo5a	UTSW	9	75136407	missense	probably damaging	1.00
R4863:Myo5a	UTSW	9	75217507	missense	probably damaging	1.00
R4902:Myo5a	UTSW	9	75174078	missense	probably benign
R4947:Myo5a	UTSW	9	75123048	missense	probably damaging	1.00
R5074:Myo5a	UTSW	9	75174156	missense	probably benign
R5095:Myo5a	UTSW	9	75152020	missense	probably damaging	1.00
R5095:Myo5a	UTSW	9	75184389	nonsense	probably null
R5254:Myo5a	UTSW	9	75130120	missense	probably damaging	1.00
R5267:Myo5a	UTSW	9	75152010	missense	probably damaging	1.00
R5419:Myo5a	UTSW	9	75147897	missense	probably damaging	1.00
R5514:Myo5a	UTSW	9	75153766	missense	probably damaging	1.00
R5629:Myo5a	UTSW	9	75203845	missense	possibly damaging	0.89
R5649:Myo5a	UTSW	9	75171719	missense	possibly damaging	0.92
R5661:Myo5a	UTSW	9	75167206	missense	probably benign	0.02
R5665:Myo5a	UTSW	9	75144181	critical splice donor site	probably null
R5719:Myo5a	UTSW	9	75151931	missense	probably damaging	1.00
R5964:Myo5a	UTSW	9	75203833	missense	probably benign	0.09
R6014:Myo5a	UTSW	9	75167207	nonsense	probably null
R6344:Myo5a	UTSW	9	75160509	missense	probably benign	0.09
R6345:Myo5a	UTSW	9	75189913	missense	possibly damaging	0.77
R6644:Myo5a	UTSW	9	75146967	missense	probably damaging	0.98
R6712:Myo5a	UTSW	9	75212900	missense	probably benign	0.12
R6838:Myo5a	UTSW	9	75153883	critical splice donor site	probably null
R6866:Myo5a	UTSW	9	75140688	missense	probably damaging	1.00
R6876:Myo5a	UTSW	9	75160490	missense	probably benign	0.04
R7108:Myo5a	UTSW	9	75129992	missense	probably damaging	1.00
R7159:Myo5a	UTSW	9	75171563	missense	probably benign	0.07
R7164:Myo5a	UTSW	9	75180153	missense	probably benign	0.00
R7219:Myo5a	UTSW	9	75120770	missense	probably damaging	1.00
R7497:Myo5a	UTSW	9	75197701	missense
R7620:Myo5a	UTSW	9	75164136	missense	probably benign	0.41
R7719:Myo5a	UTSW	9	75144084	missense	probably benign	0.01
R7810:Myo5a	UTSW	9	75160465	missense	probably benign	0.09
R7810:Myo5a	UTSW	9	75169010	missense	probably benign
R7866:Myo5a	UTSW	9	75203752	missense	probably damaging	1.00
R7939:Myo5a	UTSW	9	75189900	missense
R8050:Myo5a	UTSW	9	75181946	missense	probably damaging	0.99
R8061:Myo5a	UTSW	9	75122957	nonsense	probably null
R8326:Myo5a	UTSW	9	75217989	missense	probably damaging	0.98
R8529:Myo5a	UTSW	9	75212872	missense	probably benign	0.02
R8824:Myo5a	UTSW	9	75167046	missense	probably damaging	1.00
R8858:Myo5a	UTSW	9	75184683	missense	probably damaging	0.99
R9040:Myo5a	UTSW	9	75174059	missense	probably benign	0.07
R9092:Myo5a	UTSW	9	75147132	critical splice donor site	probably null
R9249:Myo5a	UTSW	9	75189997	missense	possibly damaging	0.67
R9274:Myo5a	UTSW	9	75189997	missense	possibly damaging	0.67
R9293:Myo5a	UTSW	9	75180030	missense	probably benign	0.37
R9366:Myo5a	UTSW	9	75217518	missense	probably damaging	0.98
R9410:Myo5a	UTSW	9	75116214	missense	probably damaging	0.98
R9644:Myo5a	UTSW	9	75136349	missense	probably damaging	1.00
R9649:Myo5a	UTSW	9	75192444	missense
R9748:Myo5a	UTSW	9	75184683	missense	probably damaging	0.99
R9766:Myo5a	UTSW	9	75171632	missense	probably damaging	0.99
X0010:Myo5a	UTSW	9	75185905	missense	probably damaging	1.00
Z1177:Myo5a	UTSW	9	75186036	missense

Predicted Primers

PCR Primer
(F):5'- AGCCCAGAGTCTTTCTTGTTG -3'
(R):5'- AATTGGGGTTAGGCAAGTTATAGC -3'

Sequencing Primer
(F):5'- CTCACTGTGCAGCTGAGATTGAC -3'
(R):5'- GGGTTAGGCAAGTTATAGCAAAATTC -3'

Posted On

2014-07-14