Incidental Mutation 'R1924:Olfr225'
ID213295
Institutional Source Beutler Lab
Gene Symbol Olfr225
Ensembl Gene ENSMUSG00000044061
Gene Nameolfactory receptor 225
SynonymsGA_x6K02T0073K-490-1545, MOR256-51
MMRRC Submission 039942-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R1924 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location59612966-59613882 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 59613123 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 53 (R53L)
Ref Sequence ENSEMBL: ENSMUSP00000051482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055276] [ENSMUST00000213169]
Predicted Effect possibly damaging
Transcript: ENSMUST00000055276
AA Change: R53L

PolyPhen 2 Score 0.584 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000051482
Gene: ENSMUSG00000044061
AA Change: R53L

DomainStartEndE-ValueType
Pfam:7tm_4 29 307 6.6e-47 PFAM
Pfam:7tm_1 40 289 4.3e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213169
AA Change: R53L

PolyPhen 2 Score 0.159 (Sensitivity: 0.92; Specificity: 0.87)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.9%
Validation Efficiency 94% (63/67)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb G A 5: 114,230,720 M1666I possibly damaging Het
Adamts13 A T 2: 26,984,141 Q434L probably damaging Het
Adgrg3 G A 8: 95,035,934 R204H probably benign Het
Arhgef28 A C 13: 97,936,816 probably benign Het
AU041133 T A 10: 82,151,267 C251* probably null Het
Axin2 T A 11: 108,942,968 N580K probably benign Het
C4b A G 17: 34,729,657 C1560R probably damaging Het
C530008M17Rik A T 5: 76,858,623 T944S unknown Het
Cacna1g A G 11: 94,444,054 I809T possibly damaging Het
Cacna1s C A 1: 136,089,017 probably null Het
Cadps2 T C 6: 23,688,858 S151G probably damaging Het
Capn1 T C 19: 5,990,056 probably null Het
Capn9 A G 8: 124,576,226 S28G probably benign Het
Ccdc73 A G 2: 104,992,292 D862G probably damaging Het
Cdk17 T C 10: 93,226,117 L237P probably damaging Het
Chad A C 11: 94,565,558 N154T possibly damaging Het
Cog1 C T 11: 113,656,212 T544I probably benign Het
Ctnna2 T C 6: 76,954,847 E590G possibly damaging Het
Dapk2 T A 9: 66,165,360 M6K probably benign Het
Dchs1 T C 7: 105,772,280 E311G possibly damaging Het
Ddr2 T A 1: 169,982,072 T779S probably benign Het
Dhtkd1 A G 2: 5,911,933 V644A probably damaging Het
Dock2 A G 11: 34,464,934 V147A possibly damaging Het
Ear10 A T 14: 43,922,900 *157K probably null Het
Gm10801 T C 2: 98,663,852 I113T probably damaging Het
Gmps T G 3: 63,998,628 C449G probably damaging Het
Grin3a A G 4: 49,844,988 S32P possibly damaging Het
Igkv1-115 A T 6: 68,161,608 D65V probably damaging Het
Klk1b4 A G 7: 44,209,681 N41S probably benign Het
Krt26 CTAGTA CTA 11: 99,333,526 probably benign Het
Lrrc8a T A 2: 30,255,250 D25E probably damaging Het
Muc5b A G 7: 141,868,223 R4426G possibly damaging Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Myo5a G T 9: 75,116,207 D17Y probably damaging Het
Nat1 C G 8: 67,491,424 L154V probably benign Het
Nek3 T A 8: 22,157,031 T163S probably damaging Het
Olfr12 T C 1: 92,620,803 L299P probably damaging Het
Olfr508 A G 7: 108,630,355 D121G probably damaging Het
Olfr773 A G 10: 129,187,175 I82T possibly damaging Het
Olfr926 T A 9: 38,877,851 I225N probably damaging Het
Olfr951 A T 9: 39,393,867 E22D possibly damaging Het
Osr1 T G 12: 9,579,268 L47R probably damaging Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Pik3ap1 T A 19: 41,302,614 N493I possibly damaging Het
Polr3e T A 7: 120,940,597 N522K probably damaging Het
Rabgap1 T A 2: 37,495,759 probably null Het
Rp1l1 C A 14: 64,031,543 A1526E probably benign Het
Scn3a T A 2: 65,461,534 I1623F probably damaging Het
Serpinb9e A G 13: 33,253,445 T104A probably benign Het
Sh3rf3 T C 10: 59,104,167 probably benign Het
Slc30a3 A G 5: 31,088,404 Y213H probably damaging Het
Sptbn4 C T 7: 27,407,138 R955H probably damaging Het
Tfb1m A T 17: 3,519,671 Y307N probably damaging Het
Tnrc6b G T 15: 80,884,206 probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Ulk1 A G 5: 110,791,070 Y501H probably damaging Het
Wdr66 A G 5: 123,302,739 I1120V possibly damaging Het
Zbtb17 A G 4: 141,464,603 H315R probably damaging Het
Zeb2 A G 2: 45,002,612 Y142H probably damaging Het
Zfr T C 15: 12,160,629 S763P possibly damaging Het
Other mutations in Olfr225
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Olfr225 APN 11 59613321 missense possibly damaging 0.86
IGL01835:Olfr225 APN 11 59613339 missense probably damaging 0.99
IGL02006:Olfr225 APN 11 59613159 missense probably damaging 1.00
IGL03195:Olfr225 APN 11 59613803 missense probably damaging 1.00
R0148:Olfr225 UTSW 11 59613494 missense probably damaging 1.00
R0831:Olfr225 UTSW 11 59613654 missense possibly damaging 0.70
R2184:Olfr225 UTSW 11 59613138 missense probably damaging 1.00
R5772:Olfr225 UTSW 11 59613886 missense probably benign
R6986:Olfr225 UTSW 11 59614098 missense possibly damaging 0.53
R7405:Olfr225 UTSW 11 59614073 missense possibly damaging 0.53
R7755:Olfr225 UTSW 11 59613641 missense probably damaging 0.97
R7851:Olfr225 UTSW 11 59613963 missense probably benign 0.33
R7934:Olfr225 UTSW 11 59613963 missense probably benign 0.33
Z1177:Olfr225 UTSW 11 59613572 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGAACAGGTCACAGCTGATG -3'
(R):5'- GGCTTGCAGACAGCTACAAAG -3'

Sequencing Primer
(F):5'- TCACAGCTGATGGAGAAGAAC -3'
(R):5'- TCGTAGGCCATAACTGACAGG -3'
Posted On2014-07-14