Incidental Mutation 'R0125:Vps8'
ID21330
Institutional Source Beutler Lab
Gene Symbol Vps8
Ensembl Gene ENSMUSG00000033653
Gene NameVPS8 CORVET complex subunit
Synonyms
MMRRC Submission 038410-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0125 (G1)
Quality Score159
Status Validated (trace)
Chromosome16
Chromosomal Location21423118-21644680 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 21470154 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 421 (V421E)
Ref Sequence ENSEMBL: ENSMUSP00000112636 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096191] [ENSMUST00000096192] [ENSMUST00000115397] [ENSMUST00000117598] [ENSMUST00000118923]
Predicted Effect probably benign
Transcript: ENSMUST00000096191
AA Change: V419E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000093905
Gene: ENSMUSG00000033653
AA Change: V419E

DomainStartEndE-ValueType
low complexity region 96 112 N/A INTRINSIC
SCOP:d1g72a_ 158 296 1e-8 SMART
Blast:WD40 184 225 7e-22 BLAST
Blast:WD40 228 268 5e-20 BLAST
Pfam:Vps8 610 794 1.7e-61 PFAM
low complexity region 992 1007 N/A INTRINSIC
low complexity region 1085 1097 N/A INTRINSIC
low complexity region 1126 1137 N/A INTRINSIC
Blast:RING 1257 1277 1e-5 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000096192
AA Change: V421E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000093906
Gene: ENSMUSG00000033653
AA Change: V421E

DomainStartEndE-ValueType
low complexity region 96 112 N/A INTRINSIC
SCOP:d1g72a_ 158 298 1e-8 SMART
Blast:WD40 186 227 8e-22 BLAST
Blast:WD40 230 270 5e-20 BLAST
Pfam:Vps8 612 796 1.4e-61 PFAM
low complexity region 969 979 N/A INTRINSIC
low complexity region 1057 1069 N/A INTRINSIC
low complexity region 1098 1109 N/A INTRINSIC
RING 1229 1280 1.23e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115397
AA Change: V421E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000111055
Gene: ENSMUSG00000033653
AA Change: V421E

DomainStartEndE-ValueType
low complexity region 96 112 N/A INTRINSIC
SCOP:d1g72a_ 158 298 8e-9 SMART
Blast:WD40 186 227 8e-22 BLAST
Blast:WD40 230 270 5e-20 BLAST
Pfam:Vps8 613 796 1.3e-61 PFAM
low complexity region 994 1009 N/A INTRINSIC
low complexity region 1087 1099 N/A INTRINSIC
low complexity region 1128 1139 N/A INTRINSIC
RING 1259 1310 1.23e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117598
AA Change: V419E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000112937
Gene: ENSMUSG00000033653
AA Change: V419E

DomainStartEndE-ValueType
low complexity region 96 112 N/A INTRINSIC
SCOP:d1g72a_ 158 296 1e-8 SMART
Blast:WD40 184 225 8e-22 BLAST
Blast:WD40 228 268 5e-20 BLAST
Pfam:Vps8 610 794 1.9e-61 PFAM
low complexity region 992 1007 N/A INTRINSIC
low complexity region 1085 1097 N/A INTRINSIC
low complexity region 1126 1137 N/A INTRINSIC
RING 1257 1308 1.23e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118923
AA Change: V421E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000112636
Gene: ENSMUSG00000033653
AA Change: V421E

DomainStartEndE-ValueType
low complexity region 96 112 N/A INTRINSIC
SCOP:d1g72a_ 158 298 9e-9 SMART
Blast:WD40 186 227 8e-22 BLAST
Blast:WD40 230 270 5e-20 BLAST
Pfam:Vps8 612 796 1.9e-61 PFAM
low complexity region 969 979 N/A INTRINSIC
low complexity region 1057 1069 N/A INTRINSIC
low complexity region 1098 1109 N/A INTRINSIC
RING 1229 1280 1.23e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125487
SMART Domains Protein: ENSMUSP00000114719
Gene: ENSMUSG00000033653

DomainStartEndE-ValueType
Pfam:Vps8 182 365 8.5e-62 PFAM
low complexity region 563 578 N/A INTRINSIC
low complexity region 656 668 N/A INTRINSIC
low complexity region 697 708 N/A INTRINSIC
RING 828 879 1.23e-4 SMART
Meta Mutation Damage Score 0.1187 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.7%
  • 20x: 87.1%
Validation Efficiency 98% (96/98)
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930012K11Rik T C 14: 70,156,647 probably benign Het
Adam23 T C 1: 63,534,356 L261P probably benign Het
Adgra3 G A 5: 50,001,852 probably benign Het
Agtr1b A G 3: 20,315,540 F301L probably benign Het
Ahnak2 G A 12: 112,785,156 T357I probably benign Het
Aldh1a7 T C 19: 20,727,066 probably benign Het
Apoh A T 11: 108,412,073 N288I probably damaging Het
Arfgap3 A G 15: 83,343,139 V24A probably benign Het
Atp6v0a1 A G 11: 101,038,851 probably null Het
Axl A T 7: 25,786,943 M112K probably benign Het
Bnc2 A C 4: 84,292,932 I425S probably damaging Het
Cdc42bpa C T 1: 179,961,198 T30M probably damaging Het
Cebpz C A 17: 78,919,888 R1051M possibly damaging Het
Ces1d A C 8: 93,175,182 probably benign Het
Chd1l T C 3: 97,587,149 N405S probably benign Het
Chodl G T 16: 78,941,423 G93V probably damaging Het
Cpeb2 C T 5: 43,238,400 probably benign Het
Crebbp A G 16: 4,117,241 probably benign Het
Crybb3 T C 5: 113,079,809 T49A possibly damaging Het
Ctps A G 4: 120,561,525 probably benign Het
Cyp26b1 A G 6: 84,574,515 Y240H probably damaging Het
Cyp2d11 A C 15: 82,389,221 V483G probably benign Het
Dnah14 A T 1: 181,752,063 N3054Y probably damaging Het
Dspp A C 5: 104,178,039 D756A unknown Het
Dst T C 1: 34,270,903 S1553P probably damaging Het
Elp4 A G 2: 105,792,214 probably null Het
Eml6 G T 11: 29,882,088 T194K probably benign Het
Evi5 A G 5: 107,795,772 I569T probably benign Het
Fam129b T A 2: 32,923,821 V682D probably benign Het
Fancm C T 12: 65,121,956 P1698S possibly damaging Het
Fhdc1 T C 3: 84,445,545 D791G probably benign Het
Frem1 A G 4: 83,011,951 Y253H probably damaging Het
Gpn3 A G 5: 122,381,418 Y196C probably benign Het
Hcls1 A G 16: 36,962,163 D398G probably benign Het
Hydin T C 8: 110,462,531 V1189A probably benign Het
Itgb3 G A 11: 104,643,963 D549N probably damaging Het
Itpr2 A G 6: 146,240,453 F1697S probably benign Het
Klk1b11 A G 7: 43,999,051 T161A probably benign Het
Kntc1 G A 5: 123,765,057 probably benign Het
Map3k19 A T 1: 127,823,100 F838Y probably benign Het
Map6 T A 7: 99,335,980 probably null Het
Mcrs1 A G 15: 99,244,727 probably benign Het
Mdn1 A T 4: 32,729,956 Y2766F probably damaging Het
Med23 C T 10: 24,900,788 H739Y probably damaging Het
Mmp17 T A 5: 129,594,582 D65E possibly damaging Het
Mmp9 T A 2: 164,951,257 L442Q probably damaging Het
Myo19 T C 11: 84,888,175 probably benign Het
Nedd1 A C 10: 92,691,929 S468A possibly damaging Het
Nlrp4d A C 7: 10,382,389 V152G probably damaging Het
Nxf1 T A 19: 8,762,806 D112E probably benign Het
Oas1h A T 5: 120,862,563 K79* probably null Het
Olfr494 A G 7: 108,368,369 Y293C probably damaging Het
Olfr888 A G 9: 38,109,519 T278A probably benign Het
Olfr904 T A 9: 38,464,461 L140* probably null Het
Omg T A 11: 79,502,853 I60F possibly damaging Het
Pck1 G A 2: 173,156,081 W314* probably null Het
Pla2g15 T C 8: 106,163,124 Y343H probably benign Het
Plcb3 T C 19: 6,958,908 E749G probably damaging Het
Plgrkt A G 19: 29,351,042 probably null Het
Pprc1 A G 19: 46,069,512 probably benign Het
Prkdc A T 16: 15,699,007 I1082F probably damaging Het
Rapgef6 T A 11: 54,625,875 Y172* probably null Het
Ros1 G T 10: 52,125,789 A1079D probably benign Het
Sap30 T C 8: 57,485,511 E147G probably null Het
Sell T C 1: 164,072,105 probably benign Het
Senp1 A T 15: 98,048,231 D544E probably damaging Het
Shpk G A 11: 73,214,222 probably benign Het
Slc35b1 A T 11: 95,386,527 T74S probably benign Het
Slc6a3 T A 13: 73,569,979 probably benign Het
Slf1 T C 13: 77,043,745 N990S probably benign Het
Smgc A G 15: 91,854,543 probably benign Het
Snx19 T A 9: 30,440,219 V861D probably damaging Het
Sprr2e C T 3: 92,352,978 P39S unknown Het
Sstr2 T A 11: 113,624,477 M74K probably damaging Het
St5 T C 7: 109,556,338 K402E probably benign Het
Svep1 T C 4: 58,099,937 probably benign Het
Tas2r143 A G 6: 42,400,955 I240V probably benign Het
Tbrg1 T C 9: 37,652,641 I233V probably benign Het
Tecpr1 G T 5: 144,197,899 D1055E probably damaging Het
Thap2 A T 10: 115,376,372 probably null Het
Tinagl1 A G 4: 130,166,308 Y388H probably damaging Het
Ttn T A 2: 76,755,552 Y21945F probably damaging Het
Ugt2b1 A T 5: 86,926,102 W133R probably benign Het
Usp24 C T 4: 106,397,299 P1491L possibly damaging Het
Utp15 A G 13: 98,250,882 S395P possibly damaging Het
Vav1 T A 17: 57,299,847 L254Q probably damaging Het
Vmn2r104 T C 17: 20,029,807 Y734C probably damaging Het
Wisp1 T C 15: 66,917,345 S227P possibly damaging Het
Xkr7 G T 2: 153,032,426 A138S probably benign Het
Other mutations in Vps8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00500:Vps8 APN 16 21442334 missense possibly damaging 0.47
IGL00596:Vps8 APN 16 21448412 splice site probably benign
IGL00985:Vps8 APN 16 21477584 splice site probably benign
IGL01356:Vps8 APN 16 21517357 critical splice donor site probably null
IGL01375:Vps8 APN 16 21559372 nonsense probably null
IGL01643:Vps8 APN 16 21518222 missense possibly damaging 0.92
IGL02159:Vps8 APN 16 21466484 missense possibly damaging 0.69
IGL02214:Vps8 APN 16 21517285 missense probably damaging 1.00
IGL02465:Vps8 APN 16 21521903 missense probably damaging 1.00
IGL02651:Vps8 APN 16 21517336 missense probably damaging 0.99
IGL03174:Vps8 APN 16 21466463 missense probably damaging 1.00
IGL03337:Vps8 APN 16 21563168 missense probably benign
IGL03383:Vps8 APN 16 21435823 critical splice donor site probably null
IGL03402:Vps8 APN 16 21448398 missense possibly damaging 0.68
empires UTSW 16 21581548 nonsense probably null
porky UTSW 16 21461238 missense probably benign 0.32
realm UTSW 16 21545236 intron probably benign
realms UTSW 16 21444188 splice site probably null
Reich UTSW 16 21478439 missense probably benign 0.29
reichen UTSW 16 21506825 splice site probably benign
IGL03052:Vps8 UTSW 16 21448365 missense probably damaging 0.99
PIT4677001:Vps8 UTSW 16 21500334 missense possibly damaging 0.94
R0066:Vps8 UTSW 16 21477523 missense possibly damaging 0.77
R0066:Vps8 UTSW 16 21477523 missense possibly damaging 0.77
R0137:Vps8 UTSW 16 21504386 splice site probably benign
R0362:Vps8 UTSW 16 21608227 intron probably benign
R0384:Vps8 UTSW 16 21506825 splice site probably benign
R0492:Vps8 UTSW 16 21442357 missense probably damaging 1.00
R0525:Vps8 UTSW 16 21540109 critical splice donor site probably null
R0531:Vps8 UTSW 16 21459811 intron probably benign
R0605:Vps8 UTSW 16 21559337 missense probably benign 0.00
R0636:Vps8 UTSW 16 21434933 missense probably benign 0.32
R0707:Vps8 UTSW 16 21442357 missense probably damaging 1.00
R0840:Vps8 UTSW 16 21456321 missense probably damaging 0.99
R1170:Vps8 UTSW 16 21459820 intron probably benign
R1203:Vps8 UTSW 16 21511557 missense probably damaging 1.00
R1482:Vps8 UTSW 16 21581598 missense probably benign 0.00
R1531:Vps8 UTSW 16 21466476 nonsense probably null
R1642:Vps8 UTSW 16 21581579 missense probably benign
R1956:Vps8 UTSW 16 21461142 missense probably damaging 1.00
R2201:Vps8 UTSW 16 21576757 missense probably damaging 1.00
R2287:Vps8 UTSW 16 21568413 missense probably damaging 1.00
R2423:Vps8 UTSW 16 21559337 missense probably benign 0.00
R3151:Vps8 UTSW 16 21442373 missense probably benign 0.04
R3943:Vps8 UTSW 16 21470123 missense probably damaging 1.00
R3944:Vps8 UTSW 16 21470123 missense probably damaging 1.00
R4043:Vps8 UTSW 16 21526396 missense probably damaging 1.00
R4302:Vps8 UTSW 16 21495914 missense probably damaging 1.00
R4398:Vps8 UTSW 16 21504466 missense probably damaging 1.00
R4477:Vps8 UTSW 16 21545236 intron probably benign
R4478:Vps8 UTSW 16 21545236 intron probably benign
R4479:Vps8 UTSW 16 21545236 intron probably benign
R4480:Vps8 UTSW 16 21545236 intron probably benign
R4571:Vps8 UTSW 16 21435775 missense probably damaging 1.00
R4653:Vps8 UTSW 16 21500210 missense probably damaging 1.00
R4664:Vps8 UTSW 16 21444188 splice site probably null
R4713:Vps8 UTSW 16 21442439 missense probably damaging 1.00
R4726:Vps8 UTSW 16 21448404 splice site probably null
R4959:Vps8 UTSW 16 21459786 missense probably damaging 1.00
R4973:Vps8 UTSW 16 21459786 missense probably damaging 1.00
R4975:Vps8 UTSW 16 21466469 missense probably damaging 1.00
R4992:Vps8 UTSW 16 21461408 missense possibly damaging 0.52
R5144:Vps8 UTSW 16 21559353 missense probably damaging 1.00
R5168:Vps8 UTSW 16 21457445 missense probably damaging 0.99
R5168:Vps8 UTSW 16 21533099 missense probably benign 0.05
R5222:Vps8 UTSW 16 21581548 nonsense probably null
R5231:Vps8 UTSW 16 21576725 missense probably damaging 1.00
R5876:Vps8 UTSW 16 21461439 critical splice donor site probably null
R5963:Vps8 UTSW 16 21470121 missense possibly damaging 0.48
R6010:Vps8 UTSW 16 21545205 intron probably benign
R6023:Vps8 UTSW 16 21461238 missense probably benign 0.32
R6173:Vps8 UTSW 16 21495932 splice site probably null
R6185:Vps8 UTSW 16 21470141 missense probably damaging 0.98
R6264:Vps8 UTSW 16 21559349 nonsense probably null
R6409:Vps8 UTSW 16 21478439 missense probably benign 0.29
R6522:Vps8 UTSW 16 21442379 missense probably damaging 0.99
R6528:Vps8 UTSW 16 21554125 nonsense probably null
R6784:Vps8 UTSW 16 21563207 missense probably benign 0.01
R7040:Vps8 UTSW 16 21575022 missense probably damaging 1.00
R7072:Vps8 UTSW 16 21581579 missense probably benign
R7103:Vps8 UTSW 16 21526441 missense probably damaging 1.00
R7149:Vps8 UTSW 16 21459776 missense probably damaging 1.00
R7195:Vps8 UTSW 16 21456282 missense probably damaging 1.00
R7206:Vps8 UTSW 16 21457421 missense probably damaging 1.00
R7403:Vps8 UTSW 16 21434972 missense possibly damaging 0.78
R7782:Vps8 UTSW 16 21511558 missense possibly damaging 0.89
R7806:Vps8 UTSW 16 21459751 missense probably damaging 1.00
R7846:Vps8 UTSW 16 21532320 missense probably benign 0.01
R7943:Vps8 UTSW 16 21477872 missense possibly damaging 0.66
R8075:Vps8 UTSW 16 21521894 missense probably damaging 0.99
R8190:Vps8 UTSW 16 21575030 missense possibly damaging 0.73
R8307:Vps8 UTSW 16 21495902 missense probably benign 0.02
R8483:Vps8 UTSW 16 21575013 missense probably damaging 0.98
R8814:Vps8 UTSW 16 21576650 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCAAGAGTTGTCCTCTGACCATC -3'
(R):5'- AATGCCACTGTGGGGAGATCAATG -3'

Sequencing Primer
(F):5'- TCCCTTATGCAAGCAGAGTG -3'
(R):5'- TGGGGAGATCAATGCTGGG -3'
Posted On2013-04-11