Incidental Mutation 'R1925:Col4a3'
ID 213317
Institutional Source Beutler Lab
Gene Symbol Col4a3
Ensembl Gene ENSMUSG00000079465
Gene Name collagen, type IV, alpha 3
Synonyms alpha3(IV), tumstatin
MMRRC Submission 039943-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1925 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 82586921-82722059 bp(+) (GRCm38)
Type of Mutation unclassified
DNA Base Change (assembly) T to G at 82711874 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119094 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113457] [ENSMUST00000125563] [ENSMUST00000152664]
AlphaFold Q9QZS0
Predicted Effect unknown
Transcript: ENSMUST00000113457
AA Change: D1394E
SMART Domains Protein: ENSMUSP00000109084
Gene: ENSMUSG00000079465
AA Change: D1394E

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Collagen 41 102 9.6e-11 PFAM
Pfam:Collagen 97 164 3.6e-11 PFAM
Pfam:Collagen 164 223 3.6e-9 PFAM
low complexity region 233 243 N/A INTRINSIC
Pfam:Collagen 284 344 2.4e-10 PFAM
low complexity region 368 393 N/A INTRINSIC
Pfam:Collagen 415 477 5e-10 PFAM
Pfam:Collagen 481 545 1e-9 PFAM
low complexity region 550 585 N/A INTRINSIC
Pfam:Collagen 588 653 8.9e-9 PFAM
Pfam:Collagen 682 744 1.1e-8 PFAM
Pfam:Collagen 743 807 6.9e-10 PFAM
Pfam:Collagen 786 847 1.5e-8 PFAM
Pfam:Collagen 845 904 1.5e-10 PFAM
Pfam:Collagen 887 946 4.1e-10 PFAM
Pfam:Collagen 948 1006 8.1e-11 PFAM
Pfam:Collagen 997 1061 2.8e-10 PFAM
Pfam:Collagen 1057 1120 2.5e-10 PFAM
Pfam:Collagen 1114 1176 1.7e-9 PFAM
Pfam:Collagen 1174 1233 1.1e-9 PFAM
Pfam:Collagen 1232 1295 6.9e-9 PFAM
low complexity region 1326 1347 N/A INTRINSIC
Pfam:Collagen 1377 1439 4.9e-11 PFAM
C4 1444 1553 3.77e-70 SMART
C4 1554 1667 3.28e-70 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125563
SMART Domains Protein: ENSMUSP00000137944
Gene: ENSMUSG00000079465

DomainStartEndE-ValueType
Pfam:C4 8 60 4.7e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152664
SMART Domains Protein: ENSMUSP00000119094
Gene: ENSMUSG00000079465

DomainStartEndE-ValueType
C4 8 117 3.77e-70 SMART
Pfam:C4 118 169 4.1e-14 PFAM
low complexity region 185 196 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181720
Meta Mutation Damage Score 0.1329 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.2%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Type IV collagen, the major structural component of basement membranes, is a multimeric protein composed of 3 alpha subunits. These subunits are encoded by 6 different genes, alpha 1 through alpha 6, each of which can form a triple helix structure with 2 other subunits to form type IV collagen. This gene encodes alpha 3. In the Goodpasture syndrome, autoantibodies bind to the collagen molecules in the basement membranes of alveoli and glomeruli. The epitopes that elicit these autoantibodies are localized largely to the non-collagenous C-terminal domain of the protein. A specific kinase phosphorylates amino acids in this same C-terminal region and the expression of this kinase is upregulated during pathogenesis. This gene is also linked to an autosomal recessive form of Alport syndrome. The mutations contributing to this syndrome are also located within the exons that encode this C-terminal region. Like the other members of the type IV collagen gene family, this gene is organized in a head-to-head conformation with another type IV collagen gene so that each gene pair shares a common promoter. [provided by RefSeq, Jun 2010]
PHENOTYPE: Homozygotes for targeted null mutations exhibit renal pathology including reduced glomerular filtration, impaired glomerular integrity, and glomerulonephrosis, resulting in uremia, proteinuria, and high mortality in young adults. Auditory thresholds aremildly increased across all test frequencies. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T C 6: 142,671,607 H577R probably damaging Het
Acvr1 T C 2: 58,447,649 M474V probably damaging Het
Adam1a A T 5: 121,519,450 C593* probably null Het
Agap2 A G 10: 127,090,875 N927S probably damaging Het
Ahctf1 T C 1: 179,770,653 H958R probably damaging Het
Apaf1 A G 10: 90,999,719 V1088A probably damaging Het
Brpf1 G T 6: 113,319,930 K958N probably damaging Het
Cadps A G 14: 12,705,726 I223T probably damaging Het
Catsperg2 T C 7: 29,697,764 M1105V probably benign Het
Clasp2 T A 9: 113,906,197 F1033L possibly damaging Het
Comtd1 T G 14: 21,847,663 E134A probably damaging Het
Cyp2c55 A T 19: 39,034,377 T320S probably benign Het
Dlx2 T C 2: 71,546,178 N72S probably benign Het
Dnhd1 T A 7: 105,652,252 V272E probably damaging Het
Dnhd1 T A 7: 105,673,854 I523N probably damaging Het
Dpysl3 T A 18: 43,332,931 I140F probably damaging Het
Elmod2 G A 8: 83,321,464 A123V probably benign Het
Etv4 T C 11: 101,771,681 probably benign Het
F3 A T 3: 121,729,383 T81S probably damaging Het
Faf2 C T 13: 54,652,052 A224V probably damaging Het
Fbn1 A T 2: 125,363,629 M1109K probably damaging Het
Fnbp4 A G 2: 90,765,843 E586G probably damaging Het
Gm10428 G T 11: 62,753,353 probably benign Het
Gm13088 T A 4: 143,654,455 T333S probably damaging Het
Gm5884 A T 6: 128,645,087 noncoding transcript Het
Gm6471 T A 7: 142,831,582 noncoding transcript Het
Gtse1 T C 15: 85,873,738 V515A probably benign Het
H2-M2 T C 17: 37,482,500 E205G probably damaging Het
Ido1 T A 8: 24,585,290 T259S possibly damaging Het
Il1r2 A G 1: 40,115,148 Y225C probably damaging Het
Kcnq3 T G 15: 66,004,809 D495A possibly damaging Het
Lrrc49 T C 9: 60,649,490 N321D probably benign Het
Lztr1 G T 16: 17,523,383 R291L probably damaging Het
Micu1 C T 10: 59,733,161 probably benign Het
Msh5 C T 17: 35,029,952 V702I probably benign Het
Myh1 T C 11: 67,211,170 I792T probably benign Het
Nav1 T A 1: 135,607,229 probably benign Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Olfr1044 T C 2: 86,171,010 D269G probably benign Het
Olfr204 A G 16: 59,314,664 S248P probably damaging Het
Olfr266 C T 3: 106,822,372 M62I probably damaging Het
Otof G C 5: 30,394,188 N340K probably benign Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Plek2 T A 12: 78,894,890 Y155F probably damaging Het
Ppa1 T A 10: 61,651,609 Y38* probably null Het
Prmt9 T A 8: 77,577,339 C684S possibly damaging Het
Rasl10a A G 11: 5,059,473 D87G possibly damaging Het
Rtn4rl1 C A 11: 75,266,038 P432Q probably benign Het
Scd4 T G 19: 44,341,384 Y265D probably damaging Het
Scn5a C T 9: 119,529,019 A719T probably benign Het
Sdk1 T A 5: 142,185,285 F1968I probably benign Het
Sh3bp5 T C 14: 31,435,923 E12G probably benign Het
Slc6a12 T A 6: 121,360,526 F390I probably benign Het
Snapin A T 3: 90,490,232 D77E possibly damaging Het
Sox2 G T 3: 34,650,671 E86* probably null Het
Sparcl1 A G 5: 104,093,354 L68P probably benign Het
Sptb T A 12: 76,622,253 E562V probably damaging Het
Taar3 A T 10: 23,950,585 H343L probably benign Het
Tanc1 T A 2: 59,724,751 V51E possibly damaging Het
Tbc1d22a T C 15: 86,239,149 S128P probably damaging Het
Thada A G 17: 84,444,499 S350P probably benign Het
Tmem161b T C 13: 84,260,229 V93A probably benign Het
Tnn T C 1: 160,097,229 Y1185C probably damaging Het
Trim43a T C 9: 88,582,318 V94A probably benign Het
Ttll12 C T 15: 83,581,775 E407K probably benign Het
Ttn T C 2: 76,725,512 E30383G probably damaging Het
Vmn1r29 T A 6: 58,308,102 M269K possibly damaging Het
Vmn2r117 A G 17: 23,478,389 S110P probably benign Het
Vmn2r6 C A 3: 64,556,277 V290L possibly damaging Het
Vmn2r8 A T 5: 108,802,153 L276Q probably damaging Het
Zan C A 5: 137,425,642 C2665F unknown Het
Zfp507 C T 7: 35,793,725 R631Q probably damaging Het
Zfp983 A G 17: 21,662,017 H287R probably damaging Het
Other mutations in Col4a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00693:Col4a3 APN 1 82697754 missense unknown
IGL00847:Col4a3 APN 1 82717869 missense probably damaging 1.00
IGL01011:Col4a3 APN 1 82682301 missense unknown
IGL01102:Col4a3 APN 1 82669720 missense unknown
IGL01102:Col4a3 APN 1 82670255 missense unknown
IGL02071:Col4a3 APN 1 82660887 critical splice donor site probably null
IGL02244:Col4a3 APN 1 82669771 splice site probably benign
IGL02380:Col4a3 APN 1 82672788 splice site probably benign
IGL02431:Col4a3 APN 1 82679623 nonsense probably null
IGL02466:Col4a3 APN 1 82670192 missense unknown
IGL02694:Col4a3 APN 1 82710794 unclassified probably benign
IGL02709:Col4a3 APN 1 82679112 missense unknown
IGL02752:Col4a3 APN 1 82660225 missense unknown
IGL02792:Col4a3 APN 1 82718803 missense probably damaging 1.00
IGL03203:Col4a3 APN 1 82672639 nonsense probably null
IGL03218:Col4a3 APN 1 82643206 splice site probably benign
FR4976:Col4a3 UTSW 1 82718906 frame shift probably null
PIT4260001:Col4a3 UTSW 1 82682761 missense unknown
PIT4515001:Col4a3 UTSW 1 82682303 missense unknown
R0035:Col4a3 UTSW 1 82672753 missense unknown
R0099:Col4a3 UTSW 1 82717993 missense probably benign 0.41
R0433:Col4a3 UTSW 1 82670219 missense unknown
R0573:Col4a3 UTSW 1 82716363 missense possibly damaging 0.83
R0606:Col4a3 UTSW 1 82672586 splice site probably benign
R0715:Col4a3 UTSW 1 82652158 splice site probably benign
R0961:Col4a3 UTSW 1 82708576 splice site probably benign
R1257:Col4a3 UTSW 1 82716365 missense probably damaging 1.00
R1264:Col4a3 UTSW 1 82643301 splice site probably benign
R1373:Col4a3 UTSW 1 82690087 splice site probably benign
R1694:Col4a3 UTSW 1 82690663 splice site probably null
R1895:Col4a3 UTSW 1 82679108 missense unknown
R1925:Col4a3 UTSW 1 82700373 missense unknown
R2033:Col4a3 UTSW 1 82718011 intron probably benign
R2044:Col4a3 UTSW 1 82696319 missense unknown
R2122:Col4a3 UTSW 1 82654957 missense unknown
R2282:Col4a3 UTSW 1 82708638 missense unknown
R2318:Col4a3 UTSW 1 82648569 splice site probably null
R2421:Col4a3 UTSW 1 82670275 splice site probably benign
R2517:Col4a3 UTSW 1 82680710 missense unknown
R2965:Col4a3 UTSW 1 82648600 missense unknown
R3085:Col4a3 UTSW 1 82651258 missense unknown
R3150:Col4a3 UTSW 1 82657137 splice site probably null
R3947:Col4a3 UTSW 1 82715332 missense probably damaging 1.00
R4756:Col4a3 UTSW 1 82716297 critical splice acceptor site probably null
R4910:Col4a3 UTSW 1 82672679 missense unknown
R4928:Col4a3 UTSW 1 82710977 unclassified probably benign
R5044:Col4a3 UTSW 1 82666546 missense unknown
R5557:Col4a3 UTSW 1 82715247 unclassified probably benign
R5761:Col4a3 UTSW 1 82716057 nonsense probably null
R5970:Col4a3 UTSW 1 82716329 missense possibly damaging 0.76
R6576:Col4a3 UTSW 1 82708574 splice site probably null
R6583:Col4a3 UTSW 1 82641476 missense unknown
R6675:Col4a3 UTSW 1 82668925 missense unknown
R7170:Col4a3 UTSW 1 82715909 splice site probably null
R7592:Col4a3 UTSW 1 82648617 missense unknown
R7624:Col4a3 UTSW 1 82718884 missense probably benign
R7994:Col4a3 UTSW 1 82662906 missense unknown
R8127:Col4a3 UTSW 1 82649760 missense unknown
R8702:Col4a3 UTSW 1 82710979 missense unknown
R8865:Col4a3 UTSW 1 82669762 critical splice donor site probably null
R8973:Col4a3 UTSW 1 82715331 missense probably benign 0.11
R9611:Col4a3 UTSW 1 82700297 missense unknown
R9665:Col4a3 UTSW 1 82690580 missense unknown
R9765:Col4a3 UTSW 1 82668957 nonsense probably null
X0067:Col4a3 UTSW 1 82716159 missense probably damaging 0.99
Z1177:Col4a3 UTSW 1 82690039 missense unknown
Predicted Primers PCR Primer
(F):5'- CATGCCAGTTAACCTTTCTGGG -3'
(R):5'- AAGTGAACATCTGGCACCCTG -3'

Sequencing Primer
(F):5'- GCCAGTTAACCTTTCTGGGATGTC -3'
(R):5'- GAACATCTGGCACCCTGACTTTG -3'
Posted On 2014-07-14