Incidental Mutation 'R1925:Tanc1'
ID213322
Institutional Source Beutler Lab
Gene Symbol Tanc1
Ensembl Gene ENSMUSG00000035168
Gene Nametetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1
Synonyms1200003E16Rik
MMRRC Submission 039943-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1925 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location59612042-59846149 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 59724751 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 51 (V51E)
Ref Sequence ENSEMBL: ENSMUSP00000123345 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037526] [ENSMUST00000112568] [ENSMUST00000139863]
Predicted Effect possibly damaging
Transcript: ENSMUST00000037526
AA Change: V51E

PolyPhen 2 Score 0.481 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000036003
Gene: ENSMUSG00000035168
AA Change: V51E

DomainStartEndE-ValueType
low complexity region 7 22 N/A INTRINSIC
low complexity region 60 78 N/A INTRINSIC
low complexity region 171 191 N/A INTRINSIC
low complexity region 229 240 N/A INTRINSIC
low complexity region 439 451 N/A INTRINSIC
low complexity region 455 475 N/A INTRINSIC
ANK 893 925 1.06e3 SMART
ANK 929 960 2.43e3 SMART
ANK 964 993 1.12e-3 SMART
Blast:ANK 997 1028 7e-12 BLAST
ANK 1037 1066 1.78e3 SMART
ANK 1075 1104 2.34e-1 SMART
ANK 1108 1137 3.71e-4 SMART
ANK 1141 1170 1.51e-4 SMART
ANK 1174 1203 4.89e-4 SMART
ANK 1207 1236 3.01e-4 SMART
ANK 1240 1269 1.99e2 SMART
TPR 1286 1319 7.49e1 SMART
TPR 1333 1366 2.35e-1 SMART
TPR 1367 1400 6.29e-2 SMART
low complexity region 1416 1432 N/A INTRINSIC
low complexity region 1454 1483 N/A INTRINSIC
low complexity region 1656 1686 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112568
AA Change: V51E

PolyPhen 2 Score 0.262 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000108187
Gene: ENSMUSG00000035168
AA Change: V51E

DomainStartEndE-ValueType
low complexity region 7 22 N/A INTRINSIC
low complexity region 60 78 N/A INTRINSIC
low complexity region 171 191 N/A INTRINSIC
low complexity region 229 240 N/A INTRINSIC
low complexity region 432 444 N/A INTRINSIC
low complexity region 448 468 N/A INTRINSIC
ANK 886 918 1.06e3 SMART
ANK 922 953 2.43e3 SMART
ANK 957 986 1.12e-3 SMART
Blast:ANK 990 1021 7e-12 BLAST
ANK 1030 1059 1.78e3 SMART
ANK 1068 1097 2.34e-1 SMART
ANK 1101 1130 3.71e-4 SMART
ANK 1134 1163 1.51e-4 SMART
ANK 1167 1196 4.89e-4 SMART
ANK 1200 1229 3.01e-4 SMART
ANK 1233 1262 1.99e2 SMART
TPR 1279 1312 7.49e1 SMART
TPR 1326 1359 2.35e-1 SMART
TPR 1360 1393 6.29e-2 SMART
low complexity region 1409 1425 N/A INTRINSIC
low complexity region 1447 1476 N/A INTRINSIC
low complexity region 1649 1679 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127013
Predicted Effect possibly damaging
Transcript: ENSMUST00000139863
AA Change: V51E

PolyPhen 2 Score 0.481 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000123345
Gene: ENSMUSG00000035168
AA Change: V51E

DomainStartEndE-ValueType
low complexity region 7 22 N/A INTRINSIC
low complexity region 60 78 N/A INTRINSIC
low complexity region 171 191 N/A INTRINSIC
low complexity region 229 240 N/A INTRINSIC
low complexity region 439 451 N/A INTRINSIC
low complexity region 455 475 N/A INTRINSIC
ANK 893 925 1.06e3 SMART
ANK 929 960 2.43e3 SMART
ANK 964 993 1.12e-3 SMART
Blast:ANK 997 1028 7e-12 BLAST
ANK 1037 1066 1.78e3 SMART
ANK 1075 1104 2.34e-1 SMART
ANK 1108 1137 3.71e-4 SMART
ANK 1141 1170 1.51e-4 SMART
ANK 1174 1203 4.89e-4 SMART
ANK 1207 1236 3.01e-4 SMART
ANK 1240 1269 1.99e2 SMART
TPR 1286 1319 7.49e1 SMART
TPR 1333 1366 2.35e-1 SMART
TPR 1367 1400 6.29e-2 SMART
low complexity region 1416 1432 N/A INTRINSIC
low complexity region 1454 1483 N/A INTRINSIC
low complexity region 1656 1686 N/A INTRINSIC
Meta Mutation Damage Score 0.0618 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.2%
Validation Efficiency 99% (79/80)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap vector exhibit decreased spine density in the CA3 region and impaired spatial memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T C 6: 142,671,607 H577R probably damaging Het
Acvr1 T C 2: 58,447,649 M474V probably damaging Het
Adam1a A T 5: 121,519,450 C593* probably null Het
Agap2 A G 10: 127,090,875 N927S probably damaging Het
Ahctf1 T C 1: 179,770,653 H958R probably damaging Het
Apaf1 A G 10: 90,999,719 V1088A probably damaging Het
Brpf1 G T 6: 113,319,930 K958N probably damaging Het
Cadps A G 14: 12,705,726 I223T probably damaging Het
Catsperg2 T C 7: 29,697,764 M1105V probably benign Het
Clasp2 T A 9: 113,906,197 F1033L possibly damaging Het
Col4a3 T A 1: 82,700,373 I1232N unknown Het
Col4a3 T G 1: 82,711,874 probably benign Het
Comtd1 T G 14: 21,847,663 E134A probably damaging Het
Cyp2c55 A T 19: 39,034,377 T320S probably benign Het
Dlx2 T C 2: 71,546,178 N72S probably benign Het
Dnhd1 T A 7: 105,652,252 V272E probably damaging Het
Dnhd1 T A 7: 105,673,854 I523N probably damaging Het
Dpysl3 T A 18: 43,332,931 I140F probably damaging Het
Elmod2 G A 8: 83,321,464 A123V probably benign Het
Etv4 T C 11: 101,771,681 probably benign Het
F3 A T 3: 121,729,383 T81S probably damaging Het
Faf2 C T 13: 54,652,052 A224V probably damaging Het
Fbn1 A T 2: 125,363,629 M1109K probably damaging Het
Fnbp4 A G 2: 90,765,843 E586G probably damaging Het
Gm10428 G T 11: 62,753,353 probably benign Het
Gm13088 T A 4: 143,654,455 T333S probably damaging Het
Gm5884 A T 6: 128,645,087 noncoding transcript Het
Gm6471 T A 7: 142,831,582 noncoding transcript Het
Gtse1 T C 15: 85,873,738 V515A probably benign Het
H2-M2 T C 17: 37,482,500 E205G probably damaging Het
Ido1 T A 8: 24,585,290 T259S possibly damaging Het
Il1r2 A G 1: 40,115,148 Y225C probably damaging Het
Kcnq3 T G 15: 66,004,809 D495A possibly damaging Het
Lrrc49 T C 9: 60,649,490 N321D probably benign Het
Lztr1 G T 16: 17,523,383 R291L probably damaging Het
Micu1 C T 10: 59,733,161 probably benign Het
Msh5 C T 17: 35,029,952 V702I probably benign Het
Myh1 T C 11: 67,211,170 I792T probably benign Het
Nav1 T A 1: 135,607,229 probably benign Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Olfr1044 T C 2: 86,171,010 D269G probably benign Het
Olfr204 A G 16: 59,314,664 S248P probably damaging Het
Olfr266 C T 3: 106,822,372 M62I probably damaging Het
Otof G C 5: 30,394,188 N340K probably benign Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Plek2 T A 12: 78,894,890 Y155F probably damaging Het
Ppa1 T A 10: 61,651,609 Y38* probably null Het
Prmt9 T A 8: 77,577,339 C684S possibly damaging Het
Rasl10a A G 11: 5,059,473 D87G possibly damaging Het
Rtn4rl1 C A 11: 75,266,038 P432Q probably benign Het
Scd4 T G 19: 44,341,384 Y265D probably damaging Het
Scn5a C T 9: 119,529,019 A719T probably benign Het
Sdk1 T A 5: 142,185,285 F1968I probably benign Het
Sh3bp5 T C 14: 31,435,923 E12G probably benign Het
Slc6a12 T A 6: 121,360,526 F390I probably benign Het
Snapin A T 3: 90,490,232 D77E possibly damaging Het
Sox2 G T 3: 34,650,671 E86* probably null Het
Sparcl1 A G 5: 104,093,354 L68P probably benign Het
Sptb T A 12: 76,622,253 E562V probably damaging Het
Taar3 A T 10: 23,950,585 H343L probably benign Het
Tbc1d22a T C 15: 86,239,149 S128P probably damaging Het
Thada A G 17: 84,444,499 S350P probably benign Het
Tmem161b T C 13: 84,260,229 V93A probably benign Het
Tnn T C 1: 160,097,229 Y1185C probably damaging Het
Trim43a T C 9: 88,582,318 V94A probably benign Het
Ttll12 C T 15: 83,581,775 E407K probably benign Het
Ttn T C 2: 76,725,512 E30383G probably damaging Het
Vmn1r29 T A 6: 58,308,102 M269K possibly damaging Het
Vmn2r117 A G 17: 23,478,389 S110P probably benign Het
Vmn2r6 C A 3: 64,556,277 V290L possibly damaging Het
Vmn2r8 A T 5: 108,802,153 L276Q probably damaging Het
Zan C A 5: 137,425,642 C2665F unknown Het
Zfp507 C T 7: 35,793,725 R631Q probably damaging Het
Zfp983 A G 17: 21,662,017 H287R probably damaging Het
Other mutations in Tanc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Tanc1 APN 2 59790841 missense possibly damaging 0.84
IGL00484:Tanc1 APN 2 59793176 missense probably benign 0.00
IGL00688:Tanc1 APN 2 59815391 missense probably damaging 1.00
IGL00765:Tanc1 APN 2 59806301 missense probably benign 0.15
IGL01576:Tanc1 APN 2 59797735 missense probably damaging 1.00
IGL01590:Tanc1 APN 2 59785473 missense probably benign
IGL02016:Tanc1 APN 2 59843590 missense probably benign 0.00
IGL02373:Tanc1 APN 2 59796028 critical splice donor site probably null
IGL02539:Tanc1 APN 2 59833258 missense probably damaging 1.00
IGL02540:Tanc1 APN 2 59833258 missense probably damaging 1.00
IGL02541:Tanc1 APN 2 59833258 missense probably damaging 1.00
IGL02543:Tanc1 APN 2 59833258 missense probably damaging 1.00
IGL02559:Tanc1 APN 2 59724654 splice site probably benign
IGL02626:Tanc1 APN 2 59799872 missense probably damaging 1.00
IGL02669:Tanc1 APN 2 59799986 missense probably damaging 1.00
IGL02902:Tanc1 APN 2 59793087 splice site probably benign
Oreja UTSW 2 59791804 synonymous silent
R0178:Tanc1 UTSW 2 59835447 nonsense probably null
R0347:Tanc1 UTSW 2 59842991 missense probably benign
R0570:Tanc1 UTSW 2 59796038 splice site probably benign
R0660:Tanc1 UTSW 2 59843884 nonsense probably null
R0664:Tanc1 UTSW 2 59843884 nonsense probably null
R0898:Tanc1 UTSW 2 59790788 missense probably damaging 1.00
R1333:Tanc1 UTSW 2 59843491 missense probably benign
R1575:Tanc1 UTSW 2 59791651 missense probably damaging 1.00
R1608:Tanc1 UTSW 2 59797694 missense possibly damaging 0.80
R1616:Tanc1 UTSW 2 59785387 missense probably damaging 1.00
R1703:Tanc1 UTSW 2 59843021 missense probably benign 0.02
R1727:Tanc1 UTSW 2 59790809 missense probably damaging 1.00
R1809:Tanc1 UTSW 2 59800097 missense probably damaging 1.00
R1812:Tanc1 UTSW 2 59791679 missense probably damaging 1.00
R1951:Tanc1 UTSW 2 59791812 missense possibly damaging 0.92
R2174:Tanc1 UTSW 2 59843833 missense possibly damaging 0.72
R2228:Tanc1 UTSW 2 59724724 missense probably benign 0.04
R2267:Tanc1 UTSW 2 59837219 critical splice donor site probably null
R4191:Tanc1 UTSW 2 59839013 missense probably damaging 1.00
R4476:Tanc1 UTSW 2 59841996 splice site probably null
R4632:Tanc1 UTSW 2 59795835 missense probably damaging 1.00
R4825:Tanc1 UTSW 2 59699422 missense probably damaging 1.00
R4982:Tanc1 UTSW 2 59799943 missense probably damaging 1.00
R5338:Tanc1 UTSW 2 59795834 missense probably damaging 1.00
R5657:Tanc1 UTSW 2 59834707 splice site probably null
R5672:Tanc1 UTSW 2 59772353 missense possibly damaging 0.81
R5703:Tanc1 UTSW 2 59795997 missense probably damaging 0.98
R5707:Tanc1 UTSW 2 59758530 missense probably benign
R5778:Tanc1 UTSW 2 59699347 critical splice acceptor site probably null
R5795:Tanc1 UTSW 2 59807582 missense possibly damaging 0.62
R5831:Tanc1 UTSW 2 59785341 missense possibly damaging 0.89
R5849:Tanc1 UTSW 2 59799904 missense probably benign 0.00
R5912:Tanc1 UTSW 2 59791686 missense possibly damaging 0.92
R5944:Tanc1 UTSW 2 59837220 critical splice donor site probably null
R6057:Tanc1 UTSW 2 59817493 missense possibly damaging 0.46
R6142:Tanc1 UTSW 2 59833222 nonsense probably null
R6179:Tanc1 UTSW 2 59842976 missense probably benign 0.42
R6185:Tanc1 UTSW 2 59791585 splice site probably null
R6192:Tanc1 UTSW 2 59838961 splice site probably null
R6196:Tanc1 UTSW 2 59844022 missense possibly damaging 0.94
R6197:Tanc1 UTSW 2 59844022 missense possibly damaging 0.94
R6230:Tanc1 UTSW 2 59842031 missense probably damaging 1.00
R6275:Tanc1 UTSW 2 59843510 missense probably benign 0.22
R6415:Tanc1 UTSW 2 59837114 missense probably benign 0.02
R6480:Tanc1 UTSW 2 59807642 missense probably damaging 1.00
R6578:Tanc1 UTSW 2 59795954 missense probably damaging 1.00
R6786:Tanc1 UTSW 2 59791806 missense probably benign 0.00
R7006:Tanc1 UTSW 2 59795844 missense probably damaging 1.00
R7133:Tanc1 UTSW 2 59797609 missense probably benign 0.16
R7381:Tanc1 UTSW 2 59785326 missense probably damaging 1.00
R7422:Tanc1 UTSW 2 59806344 missense probably benign 0.02
RF028:Tanc1 UTSW 2 59843269 small deletion probably benign
RF049:Tanc1 UTSW 2 59843269 small deletion probably benign
X0063:Tanc1 UTSW 2 59843980 nonsense probably null
X0064:Tanc1 UTSW 2 59844112 missense probably damaging 1.00
Z1176:Tanc1 UTSW 2 59772529 missense possibly damaging 0.93
Z1177:Tanc1 UTSW 2 59790887 missense probably benign
Z1177:Tanc1 UTSW 2 59791830 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGCTTGAGTTCCCCTGC -3'
(R):5'- CTCCCAGAAGATTTCTTACATGTACTC -3'

Sequencing Primer
(F):5'- TTGAGTTCCCCTGCAGGCAG -3'
(R):5'- CTTATGTTGATACTGGGATGC -3'
Posted On2014-07-14