Incidental Mutation 'R1925:Sox2'
ID 213328
Institutional Source Beutler Lab
Gene Symbol Sox2
Ensembl Gene ENSMUSG00000074637
Gene Name SRY (sex determining region Y)-box 2
Synonyms ysb, Sox-2, lcc
MMRRC Submission 039943-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R1925 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 34650405-34652461 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) G to T at 34650671 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 86 (E86*)
Ref Sequence ENSEMBL: ENSMUSP00000096755 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099151]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000099151
AA Change: E86*
SMART Domains Protein: ENSMUSP00000096755
Gene: ENSMUSG00000074637
AA Change: E86*

DomainStartEndE-ValueType
low complexity region 19 35 N/A INTRINSIC
HMG 42 112 1.8e-28 SMART
low complexity region 137 156 N/A INTRINSIC
low complexity region 248 263 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184690
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196243
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196850
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196987
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197103
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197258
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197977
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199171
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199482
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200092
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200414
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.2%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: This intronless gene encodes a member of the SRY-related HMG-box (SOX) family of transcription factors involved in the regulation of embryonic development and in the determination of cell fate. The product of this gene is required for stem-cell maintenance in the central nervous system, and also regulates gene expression in the stomach. Mutations in a similar gene in human have been associated with optic nerve hypoplasia and with syndromic microphthalmia, a severe form of structural eye malformation. This gene lies within an intron of another gene called SOX2 overlapping transcript (Sox2ot). [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for targeted null mutations implant but fail to develop an egg cylinder or epiblast, and die shortly thereafter. Other mutations that affect only regulatory elements show circling behavior and deafness, inner ear defects, and a yellow coat color. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T C 6: 142,671,607 H577R probably damaging Het
Acvr1 T C 2: 58,447,649 M474V probably damaging Het
Adam1a A T 5: 121,519,450 C593* probably null Het
Agap2 A G 10: 127,090,875 N927S probably damaging Het
Ahctf1 T C 1: 179,770,653 H958R probably damaging Het
Apaf1 A G 10: 90,999,719 V1088A probably damaging Het
Brpf1 G T 6: 113,319,930 K958N probably damaging Het
Cadps A G 14: 12,705,726 I223T probably damaging Het
Catsperg2 T C 7: 29,697,764 M1105V probably benign Het
Clasp2 T A 9: 113,906,197 F1033L possibly damaging Het
Col4a3 T A 1: 82,700,373 I1232N unknown Het
Col4a3 T G 1: 82,711,874 probably benign Het
Comtd1 T G 14: 21,847,663 E134A probably damaging Het
Cyp2c55 A T 19: 39,034,377 T320S probably benign Het
Dlx2 T C 2: 71,546,178 N72S probably benign Het
Dnhd1 T A 7: 105,652,252 V272E probably damaging Het
Dnhd1 T A 7: 105,673,854 I523N probably damaging Het
Dpysl3 T A 18: 43,332,931 I140F probably damaging Het
Elmod2 G A 8: 83,321,464 A123V probably benign Het
Etv4 T C 11: 101,771,681 probably benign Het
F3 A T 3: 121,729,383 T81S probably damaging Het
Faf2 C T 13: 54,652,052 A224V probably damaging Het
Fbn1 A T 2: 125,363,629 M1109K probably damaging Het
Fnbp4 A G 2: 90,765,843 E586G probably damaging Het
Gm10428 G T 11: 62,753,353 probably benign Het
Gm13088 T A 4: 143,654,455 T333S probably damaging Het
Gm5884 A T 6: 128,645,087 noncoding transcript Het
Gm6471 T A 7: 142,831,582 noncoding transcript Het
Gtse1 T C 15: 85,873,738 V515A probably benign Het
H2-M2 T C 17: 37,482,500 E205G probably damaging Het
Ido1 T A 8: 24,585,290 T259S possibly damaging Het
Il1r2 A G 1: 40,115,148 Y225C probably damaging Het
Kcnq3 T G 15: 66,004,809 D495A possibly damaging Het
Lrrc49 T C 9: 60,649,490 N321D probably benign Het
Lztr1 G T 16: 17,523,383 R291L probably damaging Het
Micu1 C T 10: 59,733,161 probably benign Het
Msh5 C T 17: 35,029,952 V702I probably benign Het
Myh1 T C 11: 67,211,170 I792T probably benign Het
Nav1 T A 1: 135,607,229 probably benign Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Olfr1044 T C 2: 86,171,010 D269G probably benign Het
Olfr204 A G 16: 59,314,664 S248P probably damaging Het
Olfr266 C T 3: 106,822,372 M62I probably damaging Het
Otof G C 5: 30,394,188 N340K probably benign Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Plek2 T A 12: 78,894,890 Y155F probably damaging Het
Ppa1 T A 10: 61,651,609 Y38* probably null Het
Prmt9 T A 8: 77,577,339 C684S possibly damaging Het
Rasl10a A G 11: 5,059,473 D87G possibly damaging Het
Rtn4rl1 C A 11: 75,266,038 P432Q probably benign Het
Scd4 T G 19: 44,341,384 Y265D probably damaging Het
Scn5a C T 9: 119,529,019 A719T probably benign Het
Sdk1 T A 5: 142,185,285 F1968I probably benign Het
Sh3bp5 T C 14: 31,435,923 E12G probably benign Het
Slc6a12 T A 6: 121,360,526 F390I probably benign Het
Snapin A T 3: 90,490,232 D77E possibly damaging Het
Sparcl1 A G 5: 104,093,354 L68P probably benign Het
Sptb T A 12: 76,622,253 E562V probably damaging Het
Taar3 A T 10: 23,950,585 H343L probably benign Het
Tanc1 T A 2: 59,724,751 V51E possibly damaging Het
Tbc1d22a T C 15: 86,239,149 S128P probably damaging Het
Thada A G 17: 84,444,499 S350P probably benign Het
Tmem161b T C 13: 84,260,229 V93A probably benign Het
Tnn T C 1: 160,097,229 Y1185C probably damaging Het
Trim43a T C 9: 88,582,318 V94A probably benign Het
Ttll12 C T 15: 83,581,775 E407K probably benign Het
Ttn T C 2: 76,725,512 E30383G probably damaging Het
Vmn1r29 T A 6: 58,308,102 M269K possibly damaging Het
Vmn2r117 A G 17: 23,478,389 S110P probably benign Het
Vmn2r6 C A 3: 64,556,277 V290L possibly damaging Het
Vmn2r8 A T 5: 108,802,153 L276Q probably damaging Het
Zan C A 5: 137,425,642 C2665F unknown Het
Zfp507 C T 7: 35,793,725 R631Q probably damaging Het
Zfp983 A G 17: 21,662,017 H287R probably damaging Het
Other mutations in Sox2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02578:Sox2 APN 3 34650596 missense probably benign 0.37
IGL03397:Sox2 APN 3 34650537 missense probably damaging 0.99
R1164:Sox2 UTSW 3 34650699 missense probably damaging 1.00
R1667:Sox2 UTSW 3 34650419 missense probably damaging 1.00
R1829:Sox2 UTSW 3 34650741 missense probably damaging 0.99
R2066:Sox2 UTSW 3 34651307 missense possibly damaging 0.63
R4170:Sox2 UTSW 3 34650554 missense probably damaging 0.99
R4585:Sox2 UTSW 3 34651044 missense probably benign 0.02
R4586:Sox2 UTSW 3 34651044 missense probably benign 0.02
R4703:Sox2 UTSW 3 34650713 missense probably damaging 1.00
R5509:Sox2 UTSW 3 34650789 missense probably damaging 0.98
R5549:Sox2 UTSW 3 34650993 missense probably benign 0.01
R5637:Sox2 UTSW 3 34650528 missense probably benign 0.03
R6494:Sox2 UTSW 3 34651097 missense probably benign 0.01
R7117:Sox2 UTSW 3 34650926 missense possibly damaging 0.95
R7210:Sox2 UTSW 3 34651157 missense probably damaging 1.00
R7365:Sox2 UTSW 3 34650972 missense possibly damaging 0.60
R7798:Sox2 UTSW 3 34650642 missense probably damaging 0.96
R7801:Sox2 UTSW 3 34650642 missense probably damaging 0.96
R8684:Sox2 UTSW 3 34650867 missense probably benign 0.00
R8889:Sox2 UTSW 3 34650980 missense possibly damaging 0.66
R9013:Sox2 UTSW 3 34650597 missense probably damaging 1.00
X0024:Sox2 UTSW 3 34650689 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAATCACAACAATCGCGGCG -3'
(R):5'- TCATGCTGTAGCTGCCGTTG -3'

Sequencing Primer
(F):5'- AGCGCCCGCATGTATAAC -3'
(R):5'- TGTAGCTGCCGTTGCTCCAG -3'
Posted On 2014-07-14