Incidental Mutation 'R0125:Vav1'
ID21333
Institutional Source Beutler Lab
Gene Symbol Vav1
Ensembl Gene ENSMUSG00000034116
Gene Namevav 1 oncogene
Synonyms
MMRRC Submission 038410-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.385) question?
Stock #R0125 (G1)
Quality Score182
Status Validated (trace)
Chromosome17
Chromosomal Location57279100-57328031 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 57299847 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 254 (L254Q)
Ref Sequence ENSEMBL: ENSMUSP00000126694 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005889] [ENSMUST00000112870] [ENSMUST00000169220]
Predicted Effect probably damaging
Transcript: ENSMUST00000005889
AA Change: L278Q

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000005889
Gene: ENSMUSG00000034116
AA Change: L278Q

DomainStartEndE-ValueType
CH 3 115 5.69e-15 SMART
RhoGEF 198 372 7.89e-62 SMART
PH 403 506 8.45e-12 SMART
C1 516 564 3.67e-9 SMART
SH3 595 659 1.65e-8 SMART
SH2 669 751 8.88e-25 SMART
SH3 785 841 1.44e-22 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000112870
AA Change: L278Q

PolyPhen 2 Score 0.880 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000108491
Gene: ENSMUSG00000034116
AA Change: L278Q

DomainStartEndE-ValueType
CH 3 115 5.69e-15 SMART
RhoGEF 198 372 7.89e-62 SMART
PH 403 506 8.45e-12 SMART
C1 516 564 3.67e-9 SMART
SH3 595 659 1.65e-8 SMART
SH2 633 712 3.93e-2 SMART
SH3 746 802 1.44e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000169220
AA Change: L254Q

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000126694
Gene: ENSMUSG00000034116
AA Change: L254Q

DomainStartEndE-ValueType
Pfam:CAMSAP_CH 27 79 6.2e-11 PFAM
RhoGEF 174 348 7.89e-62 SMART
PH 379 482 8.45e-12 SMART
C1 492 540 3.67e-9 SMART
SH3 571 635 1.65e-8 SMART
SH2 645 727 8.88e-25 SMART
SH3 761 817 1.44e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174878
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.7%
  • 20x: 87.1%
Validation Efficiency 98% (96/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the VAV gene family. The VAV proteins are guanine nucleotide exchange factors (GEFs) for Rho family GTPases that activate pathways leading to actin cytoskeletal rearrangements and transcriptional alterations. The encoded protein is important in hematopoiesis, playing a role in T-cell and B-cell development and activation. The encoded protein has been identified as the specific binding partner of Nef proteins from HIV-1. Coexpression and binding of these partners initiates profound morphological changes, cytoskeletal rearrangements and the JNK/SAPK signaling cascade, leading to increased levels of viral transcription and replication. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Homozygous null mutants exhibit defective T cell maturation, interleukin-2 production, and cell cycle progression. Immunoglobulin class switching is also impaired and attributed to defective T cell help. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930012K11Rik T C 14: 70,156,647 probably benign Het
Adam23 T C 1: 63,534,356 L261P probably benign Het
Adgra3 G A 5: 50,001,852 probably benign Het
Agtr1b A G 3: 20,315,540 F301L probably benign Het
Ahnak2 G A 12: 112,785,156 T357I probably benign Het
Aldh1a7 T C 19: 20,727,066 probably benign Het
Apoh A T 11: 108,412,073 N288I probably damaging Het
Arfgap3 A G 15: 83,343,139 V24A probably benign Het
Atp6v0a1 A G 11: 101,038,851 probably null Het
Axl A T 7: 25,786,943 M112K probably benign Het
Bnc2 A C 4: 84,292,932 I425S probably damaging Het
Cdc42bpa C T 1: 179,961,198 T30M probably damaging Het
Cebpz C A 17: 78,919,888 R1051M possibly damaging Het
Ces1d A C 8: 93,175,182 probably benign Het
Chd1l T C 3: 97,587,149 N405S probably benign Het
Chodl G T 16: 78,941,423 G93V probably damaging Het
Cpeb2 C T 5: 43,238,400 probably benign Het
Crebbp A G 16: 4,117,241 probably benign Het
Crybb3 T C 5: 113,079,809 T49A possibly damaging Het
Ctps A G 4: 120,561,525 probably benign Het
Cyp26b1 A G 6: 84,574,515 Y240H probably damaging Het
Cyp2d11 A C 15: 82,389,221 V483G probably benign Het
Dnah14 A T 1: 181,752,063 N3054Y probably damaging Het
Dspp A C 5: 104,178,039 D756A unknown Het
Dst T C 1: 34,270,903 S1553P probably damaging Het
Elp4 A G 2: 105,792,214 probably null Het
Eml6 G T 11: 29,882,088 T194K probably benign Het
Evi5 A G 5: 107,795,772 I569T probably benign Het
Fam129b T A 2: 32,923,821 V682D probably benign Het
Fancm C T 12: 65,121,956 P1698S possibly damaging Het
Fhdc1 T C 3: 84,445,545 D791G probably benign Het
Frem1 A G 4: 83,011,951 Y253H probably damaging Het
Gpn3 A G 5: 122,381,418 Y196C probably benign Het
Hcls1 A G 16: 36,962,163 D398G probably benign Het
Hydin T C 8: 110,462,531 V1189A probably benign Het
Itgb3 G A 11: 104,643,963 D549N probably damaging Het
Itpr2 A G 6: 146,240,453 F1697S probably benign Het
Klk1b11 A G 7: 43,999,051 T161A probably benign Het
Kntc1 G A 5: 123,765,057 probably benign Het
Map3k19 A T 1: 127,823,100 F838Y probably benign Het
Map6 T A 7: 99,335,980 probably null Het
Mcrs1 A G 15: 99,244,727 probably benign Het
Mdn1 A T 4: 32,729,956 Y2766F probably damaging Het
Med23 C T 10: 24,900,788 H739Y probably damaging Het
Mmp17 T A 5: 129,594,582 D65E possibly damaging Het
Mmp9 T A 2: 164,951,257 L442Q probably damaging Het
Myo19 T C 11: 84,888,175 probably benign Het
Nedd1 A C 10: 92,691,929 S468A possibly damaging Het
Nlrp4d A C 7: 10,382,389 V152G probably damaging Het
Nxf1 T A 19: 8,762,806 D112E probably benign Het
Oas1h A T 5: 120,862,563 K79* probably null Het
Olfr494 A G 7: 108,368,369 Y293C probably damaging Het
Olfr888 A G 9: 38,109,519 T278A probably benign Het
Olfr904 T A 9: 38,464,461 L140* probably null Het
Omg T A 11: 79,502,853 I60F possibly damaging Het
Pck1 G A 2: 173,156,081 W314* probably null Het
Pla2g15 T C 8: 106,163,124 Y343H probably benign Het
Plcb3 T C 19: 6,958,908 E749G probably damaging Het
Plgrkt A G 19: 29,351,042 probably null Het
Pprc1 A G 19: 46,069,512 probably benign Het
Prkdc A T 16: 15,699,007 I1082F probably damaging Het
Rapgef6 T A 11: 54,625,875 Y172* probably null Het
Ros1 G T 10: 52,125,789 A1079D probably benign Het
Sap30 T C 8: 57,485,511 E147G probably null Het
Sell T C 1: 164,072,105 probably benign Het
Senp1 A T 15: 98,048,231 D544E probably damaging Het
Shpk G A 11: 73,214,222 probably benign Het
Slc35b1 A T 11: 95,386,527 T74S probably benign Het
Slc6a3 T A 13: 73,569,979 probably benign Het
Slf1 T C 13: 77,043,745 N990S probably benign Het
Smgc A G 15: 91,854,543 probably benign Het
Snx19 T A 9: 30,440,219 V861D probably damaging Het
Sprr2e C T 3: 92,352,978 P39S unknown Het
Sstr2 T A 11: 113,624,477 M74K probably damaging Het
St5 T C 7: 109,556,338 K402E probably benign Het
Svep1 T C 4: 58,099,937 probably benign Het
Tas2r143 A G 6: 42,400,955 I240V probably benign Het
Tbrg1 T C 9: 37,652,641 I233V probably benign Het
Tecpr1 G T 5: 144,197,899 D1055E probably damaging Het
Thap2 A T 10: 115,376,372 probably null Het
Tinagl1 A G 4: 130,166,308 Y388H probably damaging Het
Ttn T A 2: 76,755,552 Y21945F probably damaging Het
Ugt2b1 A T 5: 86,926,102 W133R probably benign Het
Usp24 C T 4: 106,397,299 P1491L possibly damaging Het
Utp15 A G 13: 98,250,882 S395P possibly damaging Het
Vmn2r104 T C 17: 20,029,807 Y734C probably damaging Het
Vps8 T A 16: 21,470,154 V421E probably benign Het
Wisp1 T C 15: 66,917,345 S227P possibly damaging Het
Xkr7 G T 2: 153,032,426 A138S probably benign Het
Other mutations in Vav1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01071:Vav1 APN 17 57299176 missense probably benign 0.21
IGL01613:Vav1 APN 17 57307067 missense possibly damaging 0.93
IGL02032:Vav1 APN 17 57297090 missense possibly damaging 0.91
IGL02213:Vav1 APN 17 57305351 missense possibly damaging 0.84
IGL03009:Vav1 APN 17 57296582 missense probably benign 0.38
Belated UTSW 17 57301214 missense probably benign 0.06
Delayed UTSW 17 57296552 missense probably damaging 1.00
finally UTSW 17 57311860 nonsense probably null
Last UTSW 17 57296039 missense probably damaging 0.99
Late UTSW 17 57301870 missense possibly damaging 0.91
Plain_sight UTSW 17 57297122 missense probably damaging 1.00
tardive UTSW 17 57303079 nonsense probably null
R0116:Vav1 UTSW 17 57296039 missense probably damaging 0.99
R0268:Vav1 UTSW 17 57296090 missense probably damaging 1.00
R0344:Vav1 UTSW 17 57296090 missense probably damaging 1.00
R0579:Vav1 UTSW 17 57279271 missense probably benign 0.01
R0634:Vav1 UTSW 17 57303862 missense probably benign 0.00
R1313:Vav1 UTSW 17 57309498 splice site probably benign
R1345:Vav1 UTSW 17 57301214 missense probably benign 0.06
R1402:Vav1 UTSW 17 57303849 missense probably benign 0.18
R1402:Vav1 UTSW 17 57303849 missense probably benign 0.18
R1579:Vav1 UTSW 17 57297252 missense probably benign 0.05
R1872:Vav1 UTSW 17 57324750 missense probably damaging 1.00
R1971:Vav1 UTSW 17 57327697 missense probably damaging 1.00
R2197:Vav1 UTSW 17 57303140 missense probably benign 0.37
R2903:Vav1 UTSW 17 57306187 missense probably benign 0.05
R4623:Vav1 UTSW 17 57299839 splice site probably null
R4753:Vav1 UTSW 17 57306140 missense probably damaging 0.98
R4779:Vav1 UTSW 17 57296552 missense probably damaging 1.00
R5232:Vav1 UTSW 17 57303846 missense possibly damaging 0.81
R5240:Vav1 UTSW 17 57297122 missense probably damaging 1.00
R5503:Vav1 UTSW 17 57303079 nonsense probably null
R5592:Vav1 UTSW 17 57304835 missense probably benign 0.00
R5782:Vav1 UTSW 17 57296001 missense probably damaging 1.00
R5945:Vav1 UTSW 17 57301870 missense possibly damaging 0.91
R6113:Vav1 UTSW 17 57301884 missense probably benign 0.00
R6514:Vav1 UTSW 17 57327660 missense probably damaging 1.00
R6575:Vav1 UTSW 17 57305280 missense probably damaging 0.97
R6932:Vav1 UTSW 17 57302330 missense possibly damaging 0.92
R7024:Vav1 UTSW 17 57279268 missense probably damaging 1.00
R7063:Vav1 UTSW 17 57311860 nonsense probably null
R7322:Vav1 UTSW 17 57302266 missense probably benign
R7335:Vav1 UTSW 17 57296720 missense probably benign
R7474:Vav1 UTSW 17 57299102 missense probably benign 0.07
R7665:Vav1 UTSW 17 57297086 missense probably damaging 1.00
Z1176:Vav1 UTSW 17 57303853 missense probably damaging 1.00
Z1177:Vav1 UTSW 17 57303040 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- GGTCACAGGCTGTATTCTGCACTC -3'
(R):5'- TGTACACATACATGCTTGCACATACCC -3'

Sequencing Primer
(F):5'- GCTGTATTCTGCACTCTACCATTAAC -3'
(R):5'- gcttgcaCATACCCCACAC -3'
Posted On2013-04-11