Incidental Mutation 'R0125:Cebpz'
ID21334
Institutional Source Beutler Lab
Gene Symbol Cebpz
Ensembl Gene ENSMUSG00000024081
Gene NameCCAAT/enhancer binding protein zeta
SynonymsCebpa-rs1, Cbf, CBF2
MMRRC Submission 038410-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.969) question?
Stock #R0125 (G1)
Quality Score225
Status Validated (trace)
Chromosome17
Chromosomal Location78919006-78937070 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 78919888 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Methionine at position 1051 (R1051M)
Ref Sequence ENSEMBL: ENSMUSP00000024885 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024885] [ENSMUST00000063817] [ENSMUST00000180077] [ENSMUST00000192288]
Predicted Effect possibly damaging
Transcript: ENSMUST00000024885
AA Change: R1051M

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000024885
Gene: ENSMUSG00000024081
AA Change: R1051M

DomainStartEndE-ValueType
low complexity region 23 36 N/A INTRINSIC
coiled coil region 113 143 N/A INTRINSIC
Pfam:CBF 523 732 5.7e-58 PFAM
low complexity region 834 851 N/A INTRINSIC
low complexity region 881 904 N/A INTRINSIC
low complexity region 957 969 N/A INTRINSIC
low complexity region 1028 1042 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000063817
SMART Domains Protein: ENSMUSP00000068772
Gene: ENSMUSG00000062691

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000180077
SMART Domains Protein: ENSMUSP00000136411
Gene: ENSMUSG00000062691

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192288
Meta Mutation Damage Score 0.1577 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.7%
  • 20x: 87.1%
Validation Efficiency 98% (96/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the CEBP family. The encoded protein plays a role in cellular response to environmental stimuli through a transcriptional process that involves heat shock factors, conserved DNA elements (heat shock elements or HSEs) and CCAAT boxes. The protein acts as a DNA-binding transcriptional activator and regulates the heat-shock protein 70 (HSP70) promoter in a CCAAT-dependent manner. The protein is also involved in cell growth and differentiation, particularly, hematopoietic differentiation. Methylation of the promoter of this gene or mutations within the gene may be correlated with occurance of acute myeloid leukemia (AML). [provided by RefSeq, Jun 2016]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930012K11Rik T C 14: 70,156,647 probably benign Het
Adam23 T C 1: 63,534,356 L261P probably benign Het
Adgra3 G A 5: 50,001,852 probably benign Het
Agtr1b A G 3: 20,315,540 F301L probably benign Het
Ahnak2 G A 12: 112,785,156 T357I probably benign Het
Aldh1a7 T C 19: 20,727,066 probably benign Het
Apoh A T 11: 108,412,073 N288I probably damaging Het
Arfgap3 A G 15: 83,343,139 V24A probably benign Het
Atp6v0a1 A G 11: 101,038,851 probably null Het
Axl A T 7: 25,786,943 M112K probably benign Het
Bnc2 A C 4: 84,292,932 I425S probably damaging Het
Cdc42bpa C T 1: 179,961,198 T30M probably damaging Het
Ces1d A C 8: 93,175,182 probably benign Het
Chd1l T C 3: 97,587,149 N405S probably benign Het
Chodl G T 16: 78,941,423 G93V probably damaging Het
Cpeb2 C T 5: 43,238,400 probably benign Het
Crebbp A G 16: 4,117,241 probably benign Het
Crybb3 T C 5: 113,079,809 T49A possibly damaging Het
Ctps A G 4: 120,561,525 probably benign Het
Cyp26b1 A G 6: 84,574,515 Y240H probably damaging Het
Cyp2d11 A C 15: 82,389,221 V483G probably benign Het
Dnah14 A T 1: 181,752,063 N3054Y probably damaging Het
Dspp A C 5: 104,178,039 D756A unknown Het
Dst T C 1: 34,270,903 S1553P probably damaging Het
Elp4 A G 2: 105,792,214 probably null Het
Eml6 G T 11: 29,882,088 T194K probably benign Het
Evi5 A G 5: 107,795,772 I569T probably benign Het
Fam129b T A 2: 32,923,821 V682D probably benign Het
Fancm C T 12: 65,121,956 P1698S possibly damaging Het
Fhdc1 T C 3: 84,445,545 D791G probably benign Het
Frem1 A G 4: 83,011,951 Y253H probably damaging Het
Gpn3 A G 5: 122,381,418 Y196C probably benign Het
Hcls1 A G 16: 36,962,163 D398G probably benign Het
Hydin T C 8: 110,462,531 V1189A probably benign Het
Itgb3 G A 11: 104,643,963 D549N probably damaging Het
Itpr2 A G 6: 146,240,453 F1697S probably benign Het
Klk1b11 A G 7: 43,999,051 T161A probably benign Het
Kntc1 G A 5: 123,765,057 probably benign Het
Map3k19 A T 1: 127,823,100 F838Y probably benign Het
Map6 T A 7: 99,335,980 probably null Het
Mcrs1 A G 15: 99,244,727 probably benign Het
Mdn1 A T 4: 32,729,956 Y2766F probably damaging Het
Med23 C T 10: 24,900,788 H739Y probably damaging Het
Mmp17 T A 5: 129,594,582 D65E possibly damaging Het
Mmp9 T A 2: 164,951,257 L442Q probably damaging Het
Myo19 T C 11: 84,888,175 probably benign Het
Nedd1 A C 10: 92,691,929 S468A possibly damaging Het
Nlrp4d A C 7: 10,382,389 V152G probably damaging Het
Nxf1 T A 19: 8,762,806 D112E probably benign Het
Oas1h A T 5: 120,862,563 K79* probably null Het
Olfr494 A G 7: 108,368,369 Y293C probably damaging Het
Olfr888 A G 9: 38,109,519 T278A probably benign Het
Olfr904 T A 9: 38,464,461 L140* probably null Het
Omg T A 11: 79,502,853 I60F possibly damaging Het
Pck1 G A 2: 173,156,081 W314* probably null Het
Pla2g15 T C 8: 106,163,124 Y343H probably benign Het
Plcb3 T C 19: 6,958,908 E749G probably damaging Het
Plgrkt A G 19: 29,351,042 probably null Het
Pprc1 A G 19: 46,069,512 probably benign Het
Prkdc A T 16: 15,699,007 I1082F probably damaging Het
Rapgef6 T A 11: 54,625,875 Y172* probably null Het
Ros1 G T 10: 52,125,789 A1079D probably benign Het
Sap30 T C 8: 57,485,511 E147G probably null Het
Sell T C 1: 164,072,105 probably benign Het
Senp1 A T 15: 98,048,231 D544E probably damaging Het
Shpk G A 11: 73,214,222 probably benign Het
Slc35b1 A T 11: 95,386,527 T74S probably benign Het
Slc6a3 T A 13: 73,569,979 probably benign Het
Slf1 T C 13: 77,043,745 N990S probably benign Het
Smgc A G 15: 91,854,543 probably benign Het
Snx19 T A 9: 30,440,219 V861D probably damaging Het
Sprr2e C T 3: 92,352,978 P39S unknown Het
Sstr2 T A 11: 113,624,477 M74K probably damaging Het
St5 T C 7: 109,556,338 K402E probably benign Het
Svep1 T C 4: 58,099,937 probably benign Het
Tas2r143 A G 6: 42,400,955 I240V probably benign Het
Tbrg1 T C 9: 37,652,641 I233V probably benign Het
Tecpr1 G T 5: 144,197,899 D1055E probably damaging Het
Thap2 A T 10: 115,376,372 probably null Het
Tinagl1 A G 4: 130,166,308 Y388H probably damaging Het
Ttn T A 2: 76,755,552 Y21945F probably damaging Het
Ugt2b1 A T 5: 86,926,102 W133R probably benign Het
Usp24 C T 4: 106,397,299 P1491L possibly damaging Het
Utp15 A G 13: 98,250,882 S395P possibly damaging Het
Vav1 T A 17: 57,299,847 L254Q probably damaging Het
Vmn2r104 T C 17: 20,029,807 Y734C probably damaging Het
Vps8 T A 16: 21,470,154 V421E probably benign Het
Wisp1 T C 15: 66,917,345 S227P possibly damaging Het
Xkr7 G T 2: 153,032,426 A138S probably benign Het
Other mutations in Cebpz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00817:Cebpz APN 17 78934830 missense probably damaging 1.00
IGL01558:Cebpz APN 17 78935305 missense probably damaging 1.00
IGL01724:Cebpz APN 17 78935913 missense probably benign 0.01
IGL01938:Cebpz APN 17 78934961 nonsense probably null
IGL02165:Cebpz APN 17 78922169 missense probably damaging 1.00
IGL02397:Cebpz APN 17 78923261 missense possibly damaging 0.63
IGL02455:Cebpz APN 17 78935036 missense probably benign 0.16
IGL02690:Cebpz APN 17 78922557 missense probably damaging 1.00
IGL02698:Cebpz APN 17 78935574 missense probably benign 0.03
IGL02755:Cebpz APN 17 78931330 missense probably damaging 1.00
IGL02827:Cebpz APN 17 78929331 missense probably damaging 1.00
IGL03149:Cebpz APN 17 78922553 missense probably benign 0.01
cedar_hill UTSW 17 78936910 missense possibly damaging 0.87
R0138:Cebpz UTSW 17 78931391 missense probably benign
R0310:Cebpz UTSW 17 78926124 missense probably damaging 1.00
R0436:Cebpz UTSW 17 78935650 missense probably benign 0.00
R0589:Cebpz UTSW 17 78936879 missense probably damaging 1.00
R0828:Cebpz UTSW 17 78925982 missense probably benign 0.04
R1355:Cebpz UTSW 17 78935324 missense probably benign 0.01
R1367:Cebpz UTSW 17 78923313 missense probably benign
R1583:Cebpz UTSW 17 78934752 missense probably damaging 1.00
R1639:Cebpz UTSW 17 78934606 missense possibly damaging 0.49
R1818:Cebpz UTSW 17 78935376 missense probably damaging 1.00
R1885:Cebpz UTSW 17 78932116 missense probably benign 0.00
R1908:Cebpz UTSW 17 78934907 nonsense probably null
R1909:Cebpz UTSW 17 78934907 nonsense probably null
R2094:Cebpz UTSW 17 78935554 missense probably benign 0.03
R2314:Cebpz UTSW 17 78920547 critical splice donor site probably null
R2763:Cebpz UTSW 17 78935929 missense probably benign
R2874:Cebpz UTSW 17 78932103 splice site probably benign
R3807:Cebpz UTSW 17 78935418 missense probably damaging 1.00
R4012:Cebpz UTSW 17 78924467 missense probably damaging 0.98
R5344:Cebpz UTSW 17 78926113 missense possibly damaging 0.82
R5394:Cebpz UTSW 17 78922205 missense probably benign 0.34
R5711:Cebpz UTSW 17 78934611 missense probably damaging 1.00
R5902:Cebpz UTSW 17 78925937 missense probably benign 0.20
R6238:Cebpz UTSW 17 78936910 missense possibly damaging 0.87
R6257:Cebpz UTSW 17 78935832 missense probably benign 0.17
R6825:Cebpz UTSW 17 78919963 missense probably damaging 1.00
R7735:Cebpz UTSW 17 78925913 critical splice donor site probably null
R8045:Cebpz UTSW 17 78932156 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CCACAGTGACATCATGCACTTAGCC -3'
(R):5'- TCAACTATCCAGTAGAGGAGAGCAGC -3'

Sequencing Primer
(F):5'- TGCACTTAGCCTAAGCATGG -3'
(R):5'- TTACGGTCAGGGAGCGTC -3'
Posted On2013-04-11