Incidental Mutation 'R1925:Tbc1d22a'
ID 213384
Institutional Source Beutler Lab
Gene Symbol Tbc1d22a
Ensembl Gene ENSMUSG00000051864
Gene Name TBC1 domain family, member 22a
Synonyms D15Ertd781e
MMRRC Submission 039943-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1925 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 86098660-86382704 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 86123350 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 128 (S128P)
Ref Sequence ENSEMBL: ENSMUSP00000155727 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063414] [ENSMUST00000229242]
AlphaFold Q8R5A6
Predicted Effect probably benign
Transcript: ENSMUST00000063414
AA Change: S164P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000065721
Gene: ENSMUSG00000051864
AA Change: S164P

DomainStartEndE-ValueType
Blast:TBC 25 94 5e-34 BLAST
low complexity region 118 133 N/A INTRINSIC
TBC 218 471 2.35e-43 SMART
Blast:TBC 476 515 1e-9 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000229242
AA Change: S128P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.0815 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.2%
Validation Efficiency 99% (79/80)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T C 6: 142,617,333 (GRCm39) H577R probably damaging Het
Acvr1 T C 2: 58,337,661 (GRCm39) M474V probably damaging Het
Adam1a A T 5: 121,657,513 (GRCm39) C593* probably null Het
Agap2 A G 10: 126,926,744 (GRCm39) N927S probably damaging Het
Ahctf1 T C 1: 179,598,218 (GRCm39) H958R probably damaging Het
Apaf1 A G 10: 90,835,581 (GRCm39) V1088A probably damaging Het
Brpf1 G T 6: 113,296,891 (GRCm39) K958N probably damaging Het
Cadps A G 14: 12,705,726 (GRCm38) I223T probably damaging Het
Catsperg2 T C 7: 29,397,189 (GRCm39) M1105V probably benign Het
Clasp2 T A 9: 113,735,265 (GRCm39) F1033L possibly damaging Het
Col4a3 T A 1: 82,678,094 (GRCm39) I1232N unknown Het
Col4a3 T G 1: 82,689,595 (GRCm39) probably benign Het
Comtd1 T G 14: 21,897,731 (GRCm39) E134A probably damaging Het
Cyp2c55 A T 19: 39,022,821 (GRCm39) T320S probably benign Het
Dlx2 T C 2: 71,376,522 (GRCm39) N72S probably benign Het
Dnhd1 T A 7: 105,301,459 (GRCm39) V272E probably damaging Het
Dnhd1 T A 7: 105,323,061 (GRCm39) I523N probably damaging Het
Dpysl3 T A 18: 43,465,996 (GRCm39) I140F probably damaging Het
Elmod2 G A 8: 84,048,093 (GRCm39) A123V probably benign Het
Etv4 T C 11: 101,662,507 (GRCm39) probably benign Het
F3 A T 3: 121,523,032 (GRCm39) T81S probably damaging Het
Faf2 C T 13: 54,799,865 (GRCm39) A224V probably damaging Het
Fbn1 A T 2: 125,205,549 (GRCm39) M1109K probably damaging Het
Fnbp4 A G 2: 90,596,187 (GRCm39) E586G probably damaging Het
Gm10428 G T 11: 62,644,179 (GRCm39) probably benign Het
Gm5884 A T 6: 128,622,050 (GRCm39) noncoding transcript Het
Gm6471 T A 7: 142,385,319 (GRCm39) noncoding transcript Het
Gtse1 T C 15: 85,757,939 (GRCm39) V515A probably benign Het
H2-M2 T C 17: 37,793,391 (GRCm39) E205G probably damaging Het
Ido1 T A 8: 25,075,306 (GRCm39) T259S possibly damaging Het
Il1r2 A G 1: 40,154,308 (GRCm39) Y225C probably damaging Het
Kcnq3 T G 15: 65,876,658 (GRCm39) D495A possibly damaging Het
Lrrc49 T C 9: 60,556,773 (GRCm39) N321D probably benign Het
Lztr1 G T 16: 17,341,247 (GRCm39) R291L probably damaging Het
Micu1 C T 10: 59,568,983 (GRCm39) probably benign Het
Msh5 C T 17: 35,248,928 (GRCm39) V702I probably benign Het
Myh1 T C 11: 67,101,996 (GRCm39) I792T probably benign Het
Nav1 T A 1: 135,534,967 (GRCm39) probably benign Het
Ntn4 C T 10: 93,543,215 (GRCm39) R314W probably damaging Het
Or11i1 C T 3: 106,729,688 (GRCm39) M62I probably damaging Het
Or5ac22 A G 16: 59,135,027 (GRCm39) S248P probably damaging Het
Or8u9 T C 2: 86,001,354 (GRCm39) D269G probably benign Het
Otof G C 5: 30,551,532 (GRCm39) N340K probably benign Het
Pdlim2 C T 14: 70,402,228 (GRCm39) R296H probably damaging Het
Plek2 T A 12: 78,941,664 (GRCm39) Y155F probably damaging Het
Ppa1 T A 10: 61,487,388 (GRCm39) Y38* probably null Het
Pramel22 T A 4: 143,381,025 (GRCm39) T333S probably damaging Het
Prmt9 T A 8: 78,303,968 (GRCm39) C684S possibly damaging Het
Rasl10a A G 11: 5,009,473 (GRCm39) D87G possibly damaging Het
Rtn4rl1 C A 11: 75,156,864 (GRCm39) P432Q probably benign Het
Scd4 T G 19: 44,329,823 (GRCm39) Y265D probably damaging Het
Scn5a C T 9: 119,358,085 (GRCm39) A719T probably benign Het
Sdk1 T A 5: 142,171,040 (GRCm39) F1968I probably benign Het
Sh3bp5 T C 14: 31,157,880 (GRCm39) E12G probably benign Het
Slc6a12 T A 6: 121,337,485 (GRCm39) F390I probably benign Het
Snapin A T 3: 90,397,539 (GRCm39) D77E possibly damaging Het
Sox2 G T 3: 34,704,820 (GRCm39) E86* probably null Het
Sparcl1 A G 5: 104,241,220 (GRCm39) L68P probably benign Het
Sptb T A 12: 76,669,027 (GRCm39) E562V probably damaging Het
Taar3 A T 10: 23,826,483 (GRCm39) H343L probably benign Het
Tanc1 T A 2: 59,555,095 (GRCm39) V51E possibly damaging Het
Thada A G 17: 84,751,927 (GRCm39) S350P probably benign Het
Tmem161b T C 13: 84,408,348 (GRCm39) V93A probably benign Het
Tnn T C 1: 159,924,799 (GRCm39) Y1185C probably damaging Het
Trim43a T C 9: 88,464,371 (GRCm39) V94A probably benign Het
Ttll12 C T 15: 83,465,976 (GRCm39) E407K probably benign Het
Ttn T C 2: 76,555,856 (GRCm39) E30383G probably damaging Het
Vmn1r29 T A 6: 58,285,087 (GRCm39) M269K possibly damaging Het
Vmn2r117 A G 17: 23,697,363 (GRCm39) S110P probably benign Het
Vmn2r6 C A 3: 64,463,698 (GRCm39) V290L possibly damaging Het
Vmn2r8 A T 5: 108,950,019 (GRCm39) L276Q probably damaging Het
Zan C A 5: 137,423,904 (GRCm39) C2665F unknown Het
Zfp507 C T 7: 35,493,150 (GRCm39) R631Q probably damaging Het
Zfp983 A G 17: 21,880,933 (GRCm39) H287R probably damaging Het
Other mutations in Tbc1d22a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01022:Tbc1d22a APN 15 86,185,756 (GRCm39) missense probably damaging 1.00
IGL01483:Tbc1d22a APN 15 86,275,404 (GRCm39) missense probably benign 0.24
IGL02137:Tbc1d22a APN 15 86,183,870 (GRCm39) missense probably benign 0.02
IGL02543:Tbc1d22a APN 15 86,123,372 (GRCm39) missense probably benign 0.30
R0138:Tbc1d22a UTSW 15 86,183,885 (GRCm39) missense probably damaging 1.00
R1168:Tbc1d22a UTSW 15 86,176,335 (GRCm39) missense probably benign 0.01
R1294:Tbc1d22a UTSW 15 86,381,027 (GRCm39) missense probably damaging 0.98
R1565:Tbc1d22a UTSW 15 86,119,770 (GRCm39) missense possibly damaging 0.48
R1586:Tbc1d22a UTSW 15 86,235,852 (GRCm39) splice site probably null
R1703:Tbc1d22a UTSW 15 86,123,416 (GRCm39) missense probably benign 0.09
R1822:Tbc1d22a UTSW 15 86,119,770 (GRCm39) missense possibly damaging 0.48
R1823:Tbc1d22a UTSW 15 86,119,770 (GRCm39) missense possibly damaging 0.48
R1824:Tbc1d22a UTSW 15 86,119,770 (GRCm39) missense possibly damaging 0.48
R2014:Tbc1d22a UTSW 15 86,183,885 (GRCm39) missense probably damaging 0.99
R2015:Tbc1d22a UTSW 15 86,183,885 (GRCm39) missense probably damaging 0.99
R2035:Tbc1d22a UTSW 15 86,275,266 (GRCm39) splice site probably null
R4380:Tbc1d22a UTSW 15 86,235,935 (GRCm39) missense probably damaging 1.00
R4616:Tbc1d22a UTSW 15 86,119,886 (GRCm39) missense probably damaging 1.00
R4690:Tbc1d22a UTSW 15 86,196,037 (GRCm39) missense probably damaging 1.00
R4825:Tbc1d22a UTSW 15 86,235,935 (GRCm39) missense probably damaging 1.00
R4883:Tbc1d22a UTSW 15 86,381,117 (GRCm39) missense possibly damaging 0.91
R4920:Tbc1d22a UTSW 15 86,195,949 (GRCm39) missense probably benign 0.20
R4979:Tbc1d22a UTSW 15 86,275,287 (GRCm39) missense probably damaging 1.00
R5913:Tbc1d22a UTSW 15 86,235,929 (GRCm39) missense probably damaging 0.98
R5916:Tbc1d22a UTSW 15 86,098,809 (GRCm39) missense possibly damaging 0.57
R6360:Tbc1d22a UTSW 15 86,098,830 (GRCm39) missense probably damaging 1.00
R6483:Tbc1d22a UTSW 15 86,185,768 (GRCm39) missense possibly damaging 0.48
R7138:Tbc1d22a UTSW 15 86,123,356 (GRCm39) missense probably benign 0.07
R7294:Tbc1d22a UTSW 15 86,196,036 (GRCm39) missense possibly damaging 0.90
R7645:Tbc1d22a UTSW 15 86,119,742 (GRCm39) missense probably benign 0.01
R7704:Tbc1d22a UTSW 15 86,250,876 (GRCm39) missense probably damaging 1.00
R9204:Tbc1d22a UTSW 15 86,098,803 (GRCm39) missense probably benign 0.15
R9370:Tbc1d22a UTSW 15 86,123,441 (GRCm39) missense probably benign 0.00
R9459:Tbc1d22a UTSW 15 86,120,021 (GRCm39) missense possibly damaging 0.57
R9792:Tbc1d22a UTSW 15 86,119,839 (GRCm39) missense probably damaging 0.99
R9793:Tbc1d22a UTSW 15 86,119,839 (GRCm39) missense probably damaging 0.99
RF013:Tbc1d22a UTSW 15 86,183,975 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- TCCAGGCCTGTGGATATCTG -3'
(R):5'- TGGTCTTGTAAGAAACCACAACC -3'

Sequencing Primer
(F):5'- GGTGAACAGTACTTCATTAGTGAGC -3'
(R):5'- CCACTCTCAGGGACTCACCAAG -3'
Posted On 2014-07-14