Incidental Mutation 'R1926:Nckap1'
ID213413
Institutional Source Beutler Lab
Gene Symbol Nckap1
Ensembl Gene ENSMUSG00000027002
Gene NameNCK-associated protein 1
Synonymsmh19, Hem-2, Nap1, Hem2, H19
MMRRC Submission 039944-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1926 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location80500512-80581380 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80506838 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 1018 (Y1018C)
Ref Sequence ENSEMBL: ENSMUSP00000028386 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028386] [ENSMUST00000111760]
Predicted Effect probably damaging
Transcript: ENSMUST00000028386
AA Change: Y1018C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028386
Gene: ENSMUSG00000027002
AA Change: Y1018C

DomainStartEndE-ValueType
Pfam:Nckap1 8 1124 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111760
AA Change: Y1024C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000107390
Gene: ENSMUSG00000027002
AA Change: Y1024C

DomainStartEndE-ValueType
Pfam:Nckap1 9 1128 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154793
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 95.0%
  • 20x: 91.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene exhibit growth arrest at midgestation, an open neural tube, cardia bifida, defective foregut development, defects in endoderm and mesoderm migration and sometimes duplication of the anteroposterior body axis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik C T 6: 149,329,404 T1316I probably benign Het
Acsm3 C T 7: 119,777,136 T362M probably damaging Het
Ang6 A G 14: 44,002,238 V11A possibly damaging Het
Ankrd17 A G 5: 90,244,169 Y1880H probably damaging Het
BC049730 G A 7: 24,714,116 G186R probably damaging Het
Bmi1 A G 2: 18,682,273 I55V probably benign Het
Bnipl G A 3: 95,243,043 T297M probably damaging Het
Bpifa2 T C 2: 154,013,749 V198A probably benign Het
Brms1l G T 12: 55,863,161 V239F possibly damaging Het
Ccdc158 A G 5: 92,650,788 V351A probably benign Het
Ces1c A G 8: 93,127,604 F101S possibly damaging Het
Cpb2 T C 14: 75,242,397 Y15H probably benign Het
Dglucy A T 12: 100,867,155 N535I possibly damaging Het
Dopey1 C A 9: 86,523,019 H1763Q probably damaging Het
Dpy19l1 C T 9: 24,473,824 M236I probably benign Het
Efna2 T C 10: 80,186,876 Y85H probably damaging Het
Eipr1 A T 12: 28,864,837 probably null Het
Eln A T 5: 134,706,567 Y787* probably null Het
Erbb2 G C 11: 98,425,164 E364D probably benign Het
F5 A G 1: 164,179,508 T294A probably damaging Het
Fam47e A G 5: 92,585,385 T194A possibly damaging Het
Galk1 T C 11: 116,010,247 D202G probably damaging Het
Glb1l2 T C 9: 26,771,066 D163G probably damaging Het
Gmip A G 8: 69,815,520 E408G probably benign Het
Gp1ba A T 11: 70,640,889 probably benign Het
Grm3 A T 5: 9,504,881 C804S probably damaging Het
Gzmd A G 14: 56,130,280 C179R probably damaging Het
Hadhb T A 5: 30,180,937 L415Q possibly damaging Het
Ift80 T C 3: 68,916,165 Y588C probably damaging Het
Jazf1 T C 6: 53,068,531 T13A probably benign Het
Kat8 T A 7: 127,915,295 Y67* probably null Het
Kcnab1 G A 3: 65,376,512 E384K possibly damaging Het
Lhx3 A T 2: 26,202,188 Y230* probably null Het
Lmx1b T A 2: 33,564,662 M365L probably damaging Het
Ly6k G T 15: 74,797,202 P76Q probably benign Het
Map1b A T 13: 99,430,692 H1840Q unknown Het
Map3k2 A G 18: 32,203,110 I117V probably damaging Het
Med13 C A 11: 86,289,073 A1350S possibly damaging Het
Midn T C 10: 80,151,661 S109P probably damaging Het
Msh6 A G 17: 87,986,225 T803A probably benign Het
Ndufc1 A T 3: 51,407,395 N63K probably benign Het
Neb A T 2: 52,279,635 S1811R probably damaging Het
Notch1 T C 2: 26,481,657 D260G probably damaging Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Oas1g T C 5: 120,879,142 K283R probably benign Het
Obscn T C 11: 59,063,474 T4037A possibly damaging Het
Olfr1414 A G 1: 92,511,608 L140P probably damaging Het
Olfr449 T G 6: 42,838,313 L144R probably damaging Het
Otop2 A T 11: 115,326,955 T206S probably benign Het
Pamr1 A G 2: 102,640,997 probably null Het
Pkp1 G A 1: 135,877,673 T675I probably benign Het
Plxna2 G A 1: 194,762,450 V717I probably benign Het
Ptgs2 T C 1: 150,100,228 L2P possibly damaging Het
Rarg A G 15: 102,239,545 F277S probably damaging Het
Rassf5 A T 1: 131,212,339 I161N probably damaging Het
Rxfp4 A G 3: 88,652,352 V264A probably benign Het
Secisbp2l T A 2: 125,740,677 Q953L probably damaging Het
Serpinb9c T C 13: 33,150,235 I275V probably benign Het
Slc2a12 T C 10: 22,665,242 V332A probably damaging Het
Slc7a1 T C 5: 148,348,303 S127G probably damaging Het
Slc7a4 A T 16: 17,575,704 V77E probably damaging Het
Sp8 G A 12: 118,849,229 S273N possibly damaging Het
Spag6l G T 16: 16,763,057 N475K probably benign Het
St18 A G 1: 6,802,689 H216R probably benign Het
Tcirg1 C T 19: 3,902,843 probably benign Het
Tmeff1 A G 4: 48,658,788 Y87C probably damaging Het
Tmem94 T C 11: 115,792,900 V713A possibly damaging Het
Tnrc6b G T 15: 80,881,162 R955L probably damaging Het
Trip12 A G 1: 84,749,291 V1153A probably damaging Het
Tshz3 T C 7: 36,769,375 L263S probably damaging Het
Tubb6 G A 18: 67,401,321 probably null Het
Ube3a T C 7: 59,276,379 W302R probably damaging Het
Vcpkmt A T 12: 69,582,745 V81E probably damaging Het
Vmn1r175 T A 7: 23,809,041 I54F possibly damaging Het
Vwa8 T A 14: 79,020,635 N741K probably benign Het
Yeats2 A G 16: 20,214,426 T1034A probably benign Het
Zc3h6 G A 2: 128,997,795 R176Q probably damaging Het
Zfp207 T A 11: 80,395,427 Y424* probably null Het
Zfp729a A G 13: 67,619,557 V851A probably benign Het
Zkscan1 G T 5: 138,101,363 A450S probably benign Het
Zkscan3 A G 13: 21,396,446 V24A possibly damaging Het
Other mutations in Nckap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00496:Nckap1 APN 2 80506202 missense possibly damaging 0.87
IGL00896:Nckap1 APN 2 80580953 missense possibly damaging 0.59
IGL01343:Nckap1 APN 2 80519842 missense possibly damaging 0.81
IGL01593:Nckap1 APN 2 80520570 missense probably benign 0.06
IGL01677:Nckap1 APN 2 80530297 missense probably benign 0.04
IGL01873:Nckap1 APN 2 80553385 missense possibly damaging 0.95
IGL01874:Nckap1 APN 2 80525636 missense probably damaging 1.00
IGL01947:Nckap1 APN 2 80508753 missense probably damaging 1.00
IGL02268:Nckap1 APN 2 80528618 missense probably benign 0.16
IGL02348:Nckap1 APN 2 80517982 missense probably damaging 1.00
IGL03349:Nckap1 APN 2 80525560 missense probably benign 0.07
PIT4151001:Nckap1 UTSW 2 80520370 critical splice donor site probably null
R0326:Nckap1 UTSW 2 80553370 missense probably benign 0.41
R0345:Nckap1 UTSW 2 80544977 splice site probably benign
R0520:Nckap1 UTSW 2 80541530 splice site probably benign
R0603:Nckap1 UTSW 2 80512729 missense probably benign 0.19
R0924:Nckap1 UTSW 2 80554249 missense probably benign 0.34
R0930:Nckap1 UTSW 2 80554249 missense probably benign 0.34
R0964:Nckap1 UTSW 2 80547899 critical splice donor site probably null
R1122:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1123:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1124:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1125:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1127:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1182:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1234:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1236:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1384:Nckap1 UTSW 2 80533670 missense possibly damaging 0.90
R1402:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1402:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1511:Nckap1 UTSW 2 80553415 missense probably damaging 0.99
R1677:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1686:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1687:Nckap1 UTSW 2 80520585 missense probably damaging 0.96
R1717:Nckap1 UTSW 2 80512670 splice site probably benign
R1789:Nckap1 UTSW 2 80520556 missense probably benign 0.44
R1822:Nckap1 UTSW 2 80517898 missense possibly damaging 0.58
R1840:Nckap1 UTSW 2 80502250 missense possibly damaging 0.88
R1968:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1970:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R2027:Nckap1 UTSW 2 80535518 missense probably damaging 1.00
R2063:Nckap1 UTSW 2 80570150 missense probably damaging 1.00
R2504:Nckap1 UTSW 2 80530218 missense probably benign 0.40
R3824:Nckap1 UTSW 2 80540560 missense possibly damaging 0.72
R4784:Nckap1 UTSW 2 80506934 missense probably benign 0.15
R4908:Nckap1 UTSW 2 80523374 critical splice donor site probably null
R5077:Nckap1 UTSW 2 80548933 missense probably damaging 0.99
R5311:Nckap1 UTSW 2 80540122 missense probably damaging 1.00
R5439:Nckap1 UTSW 2 80512690 missense possibly damaging 0.81
R6141:Nckap1 UTSW 2 80530207 missense probably damaging 1.00
R6209:Nckap1 UTSW 2 80525602 missense probably damaging 1.00
R6226:Nckap1 UTSW 2 80508781 missense possibly damaging 0.96
R6294:Nckap1 UTSW 2 80541514 missense probably benign 0.03
R6458:Nckap1 UTSW 2 80512549 intron probably null
R6937:Nckap1 UTSW 2 80508716 missense probably damaging 1.00
R6986:Nckap1 UTSW 2 80520567 missense probably benign 0.03
R7180:Nckap1 UTSW 2 80506892 missense probably benign 0.01
R7208:Nckap1 UTSW 2 80540198 missense probably benign 0.24
R7363:Nckap1 UTSW 2 80540168 missense probably damaging 1.00
R7448:Nckap1 UTSW 2 80524541 missense probably damaging 1.00
R7513:Nckap1 UTSW 2 80502291 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- TGCACCTCTCAGCTGAACTAC -3'
(R):5'- TTCTTAGCTAGCCTAGGGAAAGAAAG -3'

Sequencing Primer
(F):5'- TCTCAGCTGAACTACACAACATTTC -3'
(R):5'- CTAGGGAAAGAAAGGAATTGTTTTTC -3'
Posted On2014-07-14