Incidental Mutation 'R1926:Kcnab1'
ID213418
Institutional Source Beutler Lab
Gene Symbol Kcnab1
Ensembl Gene ENSMUSG00000027827
Gene Namepotassium voltage-gated channel, shaker-related subfamily, beta member 1
SynonymsKvbeta1.1, mKv(beta)1, Akr8a8
MMRRC Submission 039944-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R1926 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location65109384-65378223 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 65376512 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 384 (E384K)
Ref Sequence ENSEMBL: ENSMUSP00000047480 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029414] [ENSMUST00000049230]
Predicted Effect probably benign
Transcript: ENSMUST00000029414
SMART Domains Protein: ENSMUSP00000029414
Gene: ENSMUSG00000027828

DomainStartEndE-ValueType
Pfam:TRAP-gamma 12 183 5.6e-89 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000049230
AA Change: E384K

PolyPhen 2 Score 0.731 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000047480
Gene: ENSMUSG00000027827
AA Change: E384K

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 85 390 1.8e-73 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161404
SMART Domains Protein: ENSMUSP00000125578
Gene: ENSMUSG00000027827

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 1 284 4e-68 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161979
SMART Domains Protein: ENSMUSP00000125050
Gene: ENSMUSG00000027827

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 50 355 1.2e-73 PFAM
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 95.0%
  • 20x: 91.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Potassium channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shaker-related subfamily. This member includes distinct isoforms which are encoded by alternatively spliced transcript variants of this gene. Some of these isoforms are beta subunits, which form heteromultimeric complexes with alpha subunits and modulate the activity of the pore-forming alpha subunits. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene experience some learning defects but are otherwise normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik C T 6: 149,329,404 T1316I probably benign Het
Acsm3 C T 7: 119,777,136 T362M probably damaging Het
Ang6 A G 14: 44,002,238 V11A possibly damaging Het
Ankrd17 A G 5: 90,244,169 Y1880H probably damaging Het
BC049730 G A 7: 24,714,116 G186R probably damaging Het
Bmi1 A G 2: 18,682,273 I55V probably benign Het
Bnipl G A 3: 95,243,043 T297M probably damaging Het
Bpifa2 T C 2: 154,013,749 V198A probably benign Het
Brms1l G T 12: 55,863,161 V239F possibly damaging Het
Ccdc158 A G 5: 92,650,788 V351A probably benign Het
Ces1c A G 8: 93,127,604 F101S possibly damaging Het
Cpb2 T C 14: 75,242,397 Y15H probably benign Het
Dglucy A T 12: 100,867,155 N535I possibly damaging Het
Dopey1 C A 9: 86,523,019 H1763Q probably damaging Het
Dpy19l1 C T 9: 24,473,824 M236I probably benign Het
Efna2 T C 10: 80,186,876 Y85H probably damaging Het
Eipr1 A T 12: 28,864,837 probably null Het
Eln A T 5: 134,706,567 Y787* probably null Het
Erbb2 G C 11: 98,425,164 E364D probably benign Het
F5 A G 1: 164,179,508 T294A probably damaging Het
Fam47e A G 5: 92,585,385 T194A possibly damaging Het
Galk1 T C 11: 116,010,247 D202G probably damaging Het
Glb1l2 T C 9: 26,771,066 D163G probably damaging Het
Gmip A G 8: 69,815,520 E408G probably benign Het
Gp1ba A T 11: 70,640,889 probably benign Het
Grm3 A T 5: 9,504,881 C804S probably damaging Het
Gzmd A G 14: 56,130,280 C179R probably damaging Het
Hadhb T A 5: 30,180,937 L415Q possibly damaging Het
Ift80 T C 3: 68,916,165 Y588C probably damaging Het
Jazf1 T C 6: 53,068,531 T13A probably benign Het
Kat8 T A 7: 127,915,295 Y67* probably null Het
Lhx3 A T 2: 26,202,188 Y230* probably null Het
Lmx1b T A 2: 33,564,662 M365L probably damaging Het
Ly6k G T 15: 74,797,202 P76Q probably benign Het
Map1b A T 13: 99,430,692 H1840Q unknown Het
Map3k2 A G 18: 32,203,110 I117V probably damaging Het
Med13 C A 11: 86,289,073 A1350S possibly damaging Het
Midn T C 10: 80,151,661 S109P probably damaging Het
Msh6 A G 17: 87,986,225 T803A probably benign Het
Nckap1 T C 2: 80,506,838 Y1018C probably damaging Het
Ndufc1 A T 3: 51,407,395 N63K probably benign Het
Neb A T 2: 52,279,635 S1811R probably damaging Het
Notch1 T C 2: 26,481,657 D260G probably damaging Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Oas1g T C 5: 120,879,142 K283R probably benign Het
Obscn T C 11: 59,063,474 T4037A possibly damaging Het
Olfr1414 A G 1: 92,511,608 L140P probably damaging Het
Olfr449 T G 6: 42,838,313 L144R probably damaging Het
Otop2 A T 11: 115,326,955 T206S probably benign Het
Pamr1 A G 2: 102,640,997 probably null Het
Pkp1 G A 1: 135,877,673 T675I probably benign Het
Plxna2 G A 1: 194,762,450 V717I probably benign Het
Ptgs2 T C 1: 150,100,228 L2P possibly damaging Het
Rarg A G 15: 102,239,545 F277S probably damaging Het
Rassf5 A T 1: 131,212,339 I161N probably damaging Het
Rxfp4 A G 3: 88,652,352 V264A probably benign Het
Secisbp2l T A 2: 125,740,677 Q953L probably damaging Het
Serpinb9c T C 13: 33,150,235 I275V probably benign Het
Slc2a12 T C 10: 22,665,242 V332A probably damaging Het
Slc7a1 T C 5: 148,348,303 S127G probably damaging Het
Slc7a4 A T 16: 17,575,704 V77E probably damaging Het
Sp8 G A 12: 118,849,229 S273N possibly damaging Het
Spag6l G T 16: 16,763,057 N475K probably benign Het
St18 A G 1: 6,802,689 H216R probably benign Het
Tcirg1 C T 19: 3,902,843 probably benign Het
Tmeff1 A G 4: 48,658,788 Y87C probably damaging Het
Tmem94 T C 11: 115,792,900 V713A possibly damaging Het
Tnrc6b G T 15: 80,881,162 R955L probably damaging Het
Trip12 A G 1: 84,749,291 V1153A probably damaging Het
Tshz3 T C 7: 36,769,375 L263S probably damaging Het
Tubb6 G A 18: 67,401,321 probably null Het
Ube3a T C 7: 59,276,379 W302R probably damaging Het
Vcpkmt A T 12: 69,582,745 V81E probably damaging Het
Vmn1r175 T A 7: 23,809,041 I54F possibly damaging Het
Vwa8 T A 14: 79,020,635 N741K probably benign Het
Yeats2 A G 16: 20,214,426 T1034A probably benign Het
Zc3h6 G A 2: 128,997,795 R176Q probably damaging Het
Zfp207 T A 11: 80,395,427 Y424* probably null Het
Zfp729a A G 13: 67,619,557 V851A probably benign Het
Zkscan1 G T 5: 138,101,363 A450S probably benign Het
Zkscan3 A G 13: 21,396,446 V24A possibly damaging Het
Other mutations in Kcnab1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01819:Kcnab1 APN 3 65319454 missense probably damaging 1.00
IGL01936:Kcnab1 APN 3 65358274 missense probably damaging 1.00
IGL02291:Kcnab1 APN 3 65357082 missense possibly damaging 0.94
IGL02425:Kcnab1 APN 3 65302179 missense possibly damaging 0.59
PIT4418001:Kcnab1 UTSW 3 65358320 missense probably benign 0.12
R0017:Kcnab1 UTSW 3 65357106 missense probably damaging 0.98
R0017:Kcnab1 UTSW 3 65357106 missense probably damaging 0.98
R0811:Kcnab1 UTSW 3 65297720 missense probably damaging 1.00
R0812:Kcnab1 UTSW 3 65297720 missense probably damaging 1.00
R1847:Kcnab1 UTSW 3 65302194 critical splice donor site probably null
R2064:Kcnab1 UTSW 3 65364639 missense probably benign 0.07
R2152:Kcnab1 UTSW 3 65371440 missense probably damaging 0.99
R2153:Kcnab1 UTSW 3 65371440 missense probably damaging 0.99
R2197:Kcnab1 UTSW 3 65109947 missense probably benign 0.00
R2233:Kcnab1 UTSW 3 65319467 missense probably damaging 1.00
R2235:Kcnab1 UTSW 3 65319467 missense probably damaging 1.00
R2437:Kcnab1 UTSW 3 65357014 splice site probably benign
R3916:Kcnab1 UTSW 3 65304164 critical splice donor site probably null
R4093:Kcnab1 UTSW 3 65299614 missense possibly damaging 0.96
R4347:Kcnab1 UTSW 3 65297475 intron probably benign
R4796:Kcnab1 UTSW 3 65304165 critical splice donor site probably null
R5588:Kcnab1 UTSW 3 65376555 missense possibly damaging 0.59
R7254:Kcnab1 UTSW 3 65319487 missense probably benign 0.08
R7347:Kcnab1 UTSW 3 65376531 missense probably benign 0.07
R7424:Kcnab1 UTSW 3 65266503 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- ACTTGAAGCTTATCCATTGTGGGG -3'
(R):5'- CACAGTGGTAGCAACAGCAG -3'

Sequencing Primer
(F):5'- CTTATCCATTGTGGGGCATGG -3'
(R):5'- CTCAGAGAATCCTGGGACACTAG -3'
Posted On2014-07-14