Incidental Mutation 'R1926:Slc2a12'
ID213450
Institutional Source Beutler Lab
Gene Symbol Slc2a12
Ensembl Gene ENSMUSG00000037490
Gene Namesolute carrier family 2 (facilitated glucose transporter), member 12
SynonymsGlut12, GLUT-12
MMRRC Submission 039944-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1926 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location22645011-22704285 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 22665242 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 332 (V332A)
Ref Sequence ENSEMBL: ENSMUSP00000043962 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042261]
Predicted Effect probably damaging
Transcript: ENSMUST00000042261
AA Change: V332A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043962
Gene: ENSMUSG00000037490
AA Change: V332A

DomainStartEndE-ValueType
Pfam:MFS_1 42 390 5.3e-27 PFAM
Pfam:Sugar_tr 47 381 9.1e-76 PFAM
Pfam:Sugar_tr 451 569 4e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159174
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 95.0%
  • 20x: 91.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC2A12 belongs to a family of transporters that catalyze the uptake of sugars through facilitated diffusion (Rogers et al., 2002). This family of transporters show conservation of 12 transmembrane helices as well as functionally significant amino acid residues (Joost and Thorens, 2001 [PubMed 11780753]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik C T 6: 149,329,404 T1316I probably benign Het
Acsm3 C T 7: 119,777,136 T362M probably damaging Het
Ang6 A G 14: 44,002,238 V11A possibly damaging Het
Ankrd17 A G 5: 90,244,169 Y1880H probably damaging Het
BC049730 G A 7: 24,714,116 G186R probably damaging Het
Bmi1 A G 2: 18,682,273 I55V probably benign Het
Bnipl G A 3: 95,243,043 T297M probably damaging Het
Bpifa2 T C 2: 154,013,749 V198A probably benign Het
Brms1l G T 12: 55,863,161 V239F possibly damaging Het
Ccdc158 A G 5: 92,650,788 V351A probably benign Het
Ces1c A G 8: 93,127,604 F101S possibly damaging Het
Cpb2 T C 14: 75,242,397 Y15H probably benign Het
Dglucy A T 12: 100,867,155 N535I possibly damaging Het
Dopey1 C A 9: 86,523,019 H1763Q probably damaging Het
Dpy19l1 C T 9: 24,473,824 M236I probably benign Het
Efna2 T C 10: 80,186,876 Y85H probably damaging Het
Eipr1 A T 12: 28,864,837 probably null Het
Eln A T 5: 134,706,567 Y787* probably null Het
Erbb2 G C 11: 98,425,164 E364D probably benign Het
F5 A G 1: 164,179,508 T294A probably damaging Het
Fam47e A G 5: 92,585,385 T194A possibly damaging Het
Galk1 T C 11: 116,010,247 D202G probably damaging Het
Glb1l2 T C 9: 26,771,066 D163G probably damaging Het
Gmip A G 8: 69,815,520 E408G probably benign Het
Gp1ba A T 11: 70,640,889 probably benign Het
Grm3 A T 5: 9,504,881 C804S probably damaging Het
Gzmd A G 14: 56,130,280 C179R probably damaging Het
Hadhb T A 5: 30,180,937 L415Q possibly damaging Het
Ift80 T C 3: 68,916,165 Y588C probably damaging Het
Jazf1 T C 6: 53,068,531 T13A probably benign Het
Kat8 T A 7: 127,915,295 Y67* probably null Het
Kcnab1 G A 3: 65,376,512 E384K possibly damaging Het
Lhx3 A T 2: 26,202,188 Y230* probably null Het
Lmx1b T A 2: 33,564,662 M365L probably damaging Het
Ly6k G T 15: 74,797,202 P76Q probably benign Het
Map1b A T 13: 99,430,692 H1840Q unknown Het
Map3k2 A G 18: 32,203,110 I117V probably damaging Het
Med13 C A 11: 86,289,073 A1350S possibly damaging Het
Midn T C 10: 80,151,661 S109P probably damaging Het
Msh6 A G 17: 87,986,225 T803A probably benign Het
Nckap1 T C 2: 80,506,838 Y1018C probably damaging Het
Ndufc1 A T 3: 51,407,395 N63K probably benign Het
Neb A T 2: 52,279,635 S1811R probably damaging Het
Notch1 T C 2: 26,481,657 D260G probably damaging Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Oas1g T C 5: 120,879,142 K283R probably benign Het
Obscn T C 11: 59,063,474 T4037A possibly damaging Het
Olfr1414 A G 1: 92,511,608 L140P probably damaging Het
Olfr449 T G 6: 42,838,313 L144R probably damaging Het
Otop2 A T 11: 115,326,955 T206S probably benign Het
Pamr1 A G 2: 102,640,997 probably null Het
Pkp1 G A 1: 135,877,673 T675I probably benign Het
Plxna2 G A 1: 194,762,450 V717I probably benign Het
Ptgs2 T C 1: 150,100,228 L2P possibly damaging Het
Rarg A G 15: 102,239,545 F277S probably damaging Het
Rassf5 A T 1: 131,212,339 I161N probably damaging Het
Rxfp4 A G 3: 88,652,352 V264A probably benign Het
Secisbp2l T A 2: 125,740,677 Q953L probably damaging Het
Serpinb9c T C 13: 33,150,235 I275V probably benign Het
Slc7a1 T C 5: 148,348,303 S127G probably damaging Het
Slc7a4 A T 16: 17,575,704 V77E probably damaging Het
Sp8 G A 12: 118,849,229 S273N possibly damaging Het
Spag6l G T 16: 16,763,057 N475K probably benign Het
St18 A G 1: 6,802,689 H216R probably benign Het
Tcirg1 C T 19: 3,902,843 probably benign Het
Tmeff1 A G 4: 48,658,788 Y87C probably damaging Het
Tmem94 T C 11: 115,792,900 V713A possibly damaging Het
Tnrc6b G T 15: 80,881,162 R955L probably damaging Het
Trip12 A G 1: 84,749,291 V1153A probably damaging Het
Tshz3 T C 7: 36,769,375 L263S probably damaging Het
Tubb6 G A 18: 67,401,321 probably null Het
Ube3a T C 7: 59,276,379 W302R probably damaging Het
Vcpkmt A T 12: 69,582,745 V81E probably damaging Het
Vmn1r175 T A 7: 23,809,041 I54F possibly damaging Het
Vwa8 T A 14: 79,020,635 N741K probably benign Het
Yeats2 A G 16: 20,214,426 T1034A probably benign Het
Zc3h6 G A 2: 128,997,795 R176Q probably damaging Het
Zfp207 T A 11: 80,395,427 Y424* probably null Het
Zfp729a A G 13: 67,619,557 V851A probably benign Het
Zkscan1 G T 5: 138,101,363 A450S probably benign Het
Zkscan3 A G 13: 21,396,446 V24A possibly damaging Het
Other mutations in Slc2a12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01392:Slc2a12 APN 10 22664684 missense probably damaging 0.97
IGL02472:Slc2a12 APN 10 22665155 missense probably damaging 1.00
IGL03387:Slc2a12 APN 10 22665235 missense probably damaging 1.00
IGL03412:Slc2a12 APN 10 22664969 missense probably damaging 1.00
R0537:Slc2a12 UTSW 10 22665068 missense probably damaging 1.00
R0539:Slc2a12 UTSW 10 22692230 missense probably benign 0.04
R0744:Slc2a12 UTSW 10 22702016 unclassified probably benign
R0833:Slc2a12 UTSW 10 22702016 unclassified probably benign
R1056:Slc2a12 UTSW 10 22665451 missense probably benign 0.05
R2188:Slc2a12 UTSW 10 22664837 missense probably benign 0.01
R2471:Slc2a12 UTSW 10 22664807 missense probably damaging 1.00
R4212:Slc2a12 UTSW 10 22702094 missense probably benign 0.02
R4213:Slc2a12 UTSW 10 22702094 missense probably benign 0.02
R4543:Slc2a12 UTSW 10 22664786 missense probably damaging 1.00
R5203:Slc2a12 UTSW 10 22645314 critical splice donor site probably null
R5203:Slc2a12 UTSW 10 22692218 missense probably benign
R5223:Slc2a12 UTSW 10 22702032 missense probably damaging 0.99
R5500:Slc2a12 UTSW 10 22665137 missense probably damaging 1.00
R6119:Slc2a12 UTSW 10 22665347 missense probably damaging 1.00
R6149:Slc2a12 UTSW 10 22664502 missense probably benign 0.05
R6281:Slc2a12 UTSW 10 22665320 missense probably damaging 1.00
R6330:Slc2a12 UTSW 10 22664995 missense probably benign 0.00
R6385:Slc2a12 UTSW 10 22694030 missense possibly damaging 0.69
R6623:Slc2a12 UTSW 10 22664900 missense probably damaging 1.00
R6895:Slc2a12 UTSW 10 22692185 missense probably damaging 1.00
R7080:Slc2a12 UTSW 10 22665317 missense probably benign 0.34
R7152:Slc2a12 UTSW 10 22665554 missense probably benign 0.00
R7592:Slc2a12 UTSW 10 22664903 missense probably damaging 1.00
R7641:Slc2a12 UTSW 10 22693994 missense probably damaging 0.98
R7674:Slc2a12 UTSW 10 22693994 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCTCTAAGGACAACATGAGGACC -3'
(R):5'- GCTCCCTGAGACTGCTATTG -3'

Sequencing Primer
(F):5'- CAGAATCCTGATAGGTCTGACACTG -3'
(R):5'- CAGGTTTCCTGTTGCATAGAACAC -3'
Posted On2014-07-14