Incidental Mutation 'R1937:Fryl'
ID 213526
Institutional Source Beutler Lab
Gene Symbol Fryl
Ensembl Gene ENSMUSG00000070733
Gene Name FRY like transcription coactivator
Synonyms 9030227G01Rik, 2310004H21Rik, 2510002A14Rik
MMRRC Submission 039955-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.740) question?
Stock # R1937 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 73177534-73414042 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 73290710 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 65 (S65P)
Ref Sequence ENSEMBL: ENSMUSP00000098687 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094700] [ENSMUST00000101127]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000094700
AA Change: S65P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000092289
Gene: ENSMUSG00000070733
AA Change: S65P

DomainStartEndE-ValueType
Pfam:MOR2-PAG1_N 117 649 5.7e-176 PFAM
low complexity region 873 884 N/A INTRINSIC
Pfam:MOR2-PAG1_mid 896 1141 1.3e-5 PFAM
Pfam:MOR2-PAG1_mid 1145 1331 2e-19 PFAM
Pfam:MOR2-PAG1_mid 1351 1450 1.2e-5 PFAM
low complexity region 1476 1487 N/A INTRINSIC
low complexity region 1530 1548 N/A INTRINSIC
Pfam:MOR2-PAG1_mid 1590 1660 1.1e-5 PFAM
Pfam:MOR2-PAG1_mid 1725 1866 3.2e-15 PFAM
low complexity region 1973 1984 N/A INTRINSIC
Pfam:MOR2-PAG1_C 2002 2255 9.9e-78 PFAM
low complexity region 2329 2341 N/A INTRINSIC
low complexity region 2473 2482 N/A INTRINSIC
low complexity region 2485 2500 N/A INTRINSIC
low complexity region 2523 2534 N/A INTRINSIC
coiled coil region 2625 2649 N/A INTRINSIC
low complexity region 2827 2841 N/A INTRINSIC
coiled coil region 2854 2893 N/A INTRINSIC
coiled coil region 2963 2989 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000101127
AA Change: S65P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000098687
Gene: ENSMUSG00000070733
AA Change: S65P

DomainStartEndE-ValueType
Pfam:MOR2-PAG1_N 116 649 3e-172 PFAM
low complexity region 873 884 N/A INTRINSIC
Pfam:MOR2-PAG1_mid 898 1115 7.8e-6 PFAM
Pfam:MOR2-PAG1_mid 1147 1331 9.5e-19 PFAM
Pfam:MOR2-PAG1_mid 1351 1503 1.1e-5 PFAM
low complexity region 1530 1548 N/A INTRINSIC
Pfam:MOR2-PAG1_mid 1589 1664 6e-6 PFAM
Pfam:MOR2-PAG1_mid 1725 1866 1.6e-14 PFAM
low complexity region 1973 1984 N/A INTRINSIC
Pfam:MOR2-PAG1_C 1998 2260 4.4e-76 PFAM
low complexity region 2329 2341 N/A INTRINSIC
low complexity region 2473 2482 N/A INTRINSIC
low complexity region 2485 2500 N/A INTRINSIC
low complexity region 2523 2534 N/A INTRINSIC
coiled coil region 2625 2649 N/A INTRINSIC
low complexity region 2827 2841 N/A INTRINSIC
coiled coil region 2854 2893 N/A INTRINSIC
coiled coil region 2963 2989 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148433
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153923
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.7%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Most mice homozygous for a knock-out allele exhibit postnatal lethality and defects in kidney development; rare survivors display growth retardation, decreased body weight, and premature death associated with chronic hydronephrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730480H06Rik C A 5: 48,531,777 (GRCm39) T35K probably benign Het
Abhd14a A G 9: 106,317,446 (GRCm39) probably benign Het
Abhd8 A G 8: 71,914,506 (GRCm39) F41L possibly damaging Het
Ace2 A T X: 162,939,524 (GRCm39) M123L possibly damaging Het
Actr5 T C 2: 158,477,949 (GRCm39) Y440H possibly damaging Het
Akr1c6 T A 13: 4,496,383 (GRCm39) N81K probably benign Het
Aqp11 T A 7: 97,386,725 (GRCm39) N157I possibly damaging Het
Arhgap10 T C 8: 78,071,282 (GRCm39) E568G probably damaging Het
Asb7 T A 7: 66,329,001 (GRCm39) Q13L probably benign Het
Atf7ip C A 6: 136,537,778 (GRCm39) A345E probably benign Het
Atp8a2 T C 14: 60,097,719 (GRCm39) K770E probably benign Het
Bpifb4 A T 2: 153,785,996 (GRCm39) I259F probably damaging Het
Cand1 A T 10: 119,038,925 (GRCm39) D1218E probably damaging Het
Capg A G 6: 72,535,236 (GRCm39) probably null Het
Cep290 C T 10: 100,333,815 (GRCm39) T289M possibly damaging Het
Cfap69 T C 5: 5,643,818 (GRCm39) Y548C probably damaging Het
Cfap97d1 A T 11: 101,877,989 (GRCm39) H17L probably damaging Het
Cimip2b T A 4: 43,427,586 (GRCm39) K220N probably damaging Het
Clock A G 5: 76,377,340 (GRCm39) L652P probably damaging Het
Col3a1 C T 1: 45,373,453 (GRCm39) probably benign Het
Coro7 T C 16: 4,446,596 (GRCm39) E843G probably benign Het
Crebrf T C 17: 26,961,442 (GRCm39) S188P probably damaging Het
Crppa G A 12: 36,440,367 (GRCm39) V92I probably benign Het
Cul1 T C 6: 47,485,289 (GRCm39) F307L probably benign Het
Cyb561d2 G A 9: 107,417,515 (GRCm39) R79W probably damaging Het
Cyp3a59 T C 5: 146,031,187 (GRCm39) S117P possibly damaging Het
Ddias A G 7: 92,507,830 (GRCm39) I695T probably benign Het
Dhx29 G A 13: 113,101,864 (GRCm39) G1311D probably benign Het
Dync2h1 A G 9: 7,139,159 (GRCm39) probably null Het
Ece2 T A 16: 20,436,616 (GRCm39) V146E probably damaging Het
Eml2 A G 7: 18,937,889 (GRCm39) K586E possibly damaging Het
Eps8l3 A G 3: 107,791,708 (GRCm39) E316G probably benign Het
Fam135b A T 15: 71,493,863 (GRCm39) L22H probably damaging Het
Focad T A 4: 88,319,318 (GRCm39) M1K probably null Het
Gm14190 C T 11: 99,581,556 (GRCm39) C4Y unknown Het
H2-T5 T A 17: 36,478,899 (GRCm39) T117S probably damaging Het
Ift74 T A 4: 94,550,883 (GRCm39) M345K probably benign Het
Jag1 C G 2: 136,925,393 (GRCm39) V1070L possibly damaging Het
Kcng1 T C 2: 168,104,941 (GRCm39) T302A probably benign Het
Kif20b T C 19: 34,930,278 (GRCm39) V1221A possibly damaging Het
Kif23 A T 9: 61,853,892 (GRCm39) probably null Het
Lpxn T G 19: 12,802,274 (GRCm39) S200A probably benign Het
Meiob A G 17: 25,037,305 (GRCm39) H61R probably benign Het
Mfhas1 C T 8: 36,056,799 (GRCm39) L425F probably damaging Het
Myo3a A T 2: 22,401,126 (GRCm39) S632C probably damaging Het
Naip2 T C 13: 100,298,362 (GRCm39) E558G probably benign Het
Naip2 C T 13: 100,298,368 (GRCm39) G556D probably benign Het
Nbeal1 T A 1: 60,307,100 (GRCm39) Y374* probably null Het
Notch3 T C 17: 32,372,826 (GRCm39) S582G probably benign Het
Nphs1 A T 7: 30,173,798 (GRCm39) Q985L probably damaging Het
Oas1c T A 5: 120,941,049 (GRCm39) H248L probably benign Het
Or5c1 A T 2: 37,221,896 (GRCm39) N46Y probably damaging Het
Or5g26 T C 2: 85,494,341 (GRCm39) I146V probably benign Het
Or5h25 A T 16: 58,930,157 (GRCm39) M272K probably benign Het
Or8g35 A G 9: 39,381,333 (GRCm39) S230P possibly damaging Het
Pamr1 A T 2: 102,472,617 (GRCm39) I639F possibly damaging Het
Panx1 G T 9: 14,918,980 (GRCm39) T293K possibly damaging Het
Papss1 G T 3: 131,305,632 (GRCm39) V226F probably benign Het
Pax1 G T 2: 147,209,809 (GRCm39) G301V possibly damaging Het
Pdlim5 C A 3: 141,950,742 (GRCm39) R557L possibly damaging Het
Pdyn C A 2: 129,531,729 (GRCm39) M20I probably benign Het
Pelp1 G A 11: 70,284,541 (GRCm39) probably null Het
Pkd2 T C 5: 104,626,790 (GRCm39) V324A probably damaging Het
Pkdrej A G 15: 85,703,368 (GRCm39) I856T probably benign Het
Polr1a T C 6: 71,913,536 (GRCm39) probably null Het
Pot1a A T 6: 25,753,323 (GRCm39) D404E probably benign Het
Ppp2r2a A T 14: 67,253,878 (GRCm39) I430N possibly damaging Het
Prob1 C T 18: 35,787,279 (GRCm39) R325Q possibly damaging Het
Prrc2a T C 17: 35,376,884 (GRCm39) D742G probably damaging Het
Psmc1 C T 12: 100,081,102 (GRCm39) P54S probably benign Het
Rab22a A G 2: 173,530,004 (GRCm39) T61A probably damaging Het
Rims1 T A 1: 22,358,754 (GRCm39) K184N probably damaging Het
Rnf213 G A 11: 119,322,511 (GRCm39) R1376H probably damaging Het
Ryr2 T C 13: 11,683,848 (GRCm39) E3072G probably damaging Het
Serpina1b T C 12: 103,698,420 (GRCm39) K143R probably benign Het
Slc22a15 T G 3: 101,787,505 (GRCm39) probably null Het
Slc25a14 G A X: 47,740,840 (GRCm39) V210I probably benign Het
Slc25a48 A C 13: 56,596,811 (GRCm39) T31P probably damaging Het
Slc9a3 C T 13: 74,314,175 (GRCm39) probably null Het
Slx4 T C 16: 3,805,030 (GRCm39) *105W probably null Het
Smc6 A G 12: 11,349,399 (GRCm39) N794S probably benign Het
Spata18 G A 5: 73,834,307 (GRCm39) R387Q probably damaging Het
Sphkap C A 1: 83,245,162 (GRCm39) E1486* probably null Het
Srsf6 C T 2: 162,776,403 (GRCm39) probably benign Het
St8sia1 C T 6: 142,909,398 (GRCm39) A33T probably damaging Het
Tet2 T C 3: 133,194,399 (GRCm39) T12A possibly damaging Het
Tmem144 G T 3: 79,732,611 (GRCm39) S222R probably damaging Het
Tnrc6c A G 11: 117,646,849 (GRCm39) D1450G possibly damaging Het
Top1 A T 2: 160,512,042 (GRCm39) K27N unknown Het
Tox2 A G 2: 163,067,476 (GRCm39) H30R probably benign Het
Tra2b T C 16: 22,065,993 (GRCm39) probably benign Het
Trio A T 15: 27,833,142 (GRCm39) V1165E probably damaging Het
Troap T A 15: 98,975,269 (GRCm39) S145R probably damaging Het
Ttc34 G A 4: 154,950,139 (GRCm39) A1031T possibly damaging Het
Ttc6 C T 12: 57,663,109 (GRCm39) P302S probably benign Het
Ubiad1 A G 4: 148,528,468 (GRCm39) L147P probably damaging Het
Ugt2b35 G T 5: 87,149,141 (GRCm39) V131F probably damaging Het
Utp25 A T 1: 192,804,401 (GRCm39) D200E probably damaging Het
Vmn1r167 G A 7: 23,204,452 (GRCm39) T188I probably benign Het
Vmn1r46 G T 6: 89,953,716 (GRCm39) M188I probably benign Het
Vmn2r115 T A 17: 23,578,388 (GRCm39) N620K probably damaging Het
Vmn2r66 A G 7: 84,644,344 (GRCm39) S689P probably damaging Het
Wipf2 C T 11: 98,783,236 (GRCm39) R221* probably null Het
Zbtb16 T C 9: 48,571,078 (GRCm39) S563G probably benign Het
Zfp319 T C 8: 96,055,199 (GRCm39) T335A probably damaging Het
Zfp418 A G 7: 7,185,401 (GRCm39) R455G possibly damaging Het
Other mutations in Fryl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00819:Fryl APN 5 73,305,451 (GRCm39) missense possibly damaging 0.92
IGL01518:Fryl APN 5 73,244,305 (GRCm39) missense possibly damaging 0.76
IGL01545:Fryl APN 5 73,211,940 (GRCm39) missense probably damaging 1.00
IGL01646:Fryl APN 5 73,179,844 (GRCm39) critical splice donor site probably null
IGL01938:Fryl APN 5 73,279,707 (GRCm39) missense probably damaging 0.98
IGL01962:Fryl APN 5 73,190,134 (GRCm39) missense possibly damaging 0.62
IGL02064:Fryl APN 5 73,282,112 (GRCm39) unclassified probably benign
IGL02148:Fryl APN 5 73,233,302 (GRCm39) missense probably benign 0.35
IGL02418:Fryl APN 5 73,267,519 (GRCm39) splice site probably benign
IGL02431:Fryl APN 5 73,255,651 (GRCm39) missense probably benign 0.02
IGL02513:Fryl APN 5 73,222,636 (GRCm39) missense probably damaging 1.00
IGL02557:Fryl APN 5 73,255,736 (GRCm39) missense probably damaging 1.00
IGL02625:Fryl APN 5 73,227,220 (GRCm39) intron probably benign
IGL02642:Fryl APN 5 73,252,809 (GRCm39) missense probably benign
IGL02657:Fryl APN 5 73,212,203 (GRCm39) missense probably benign 0.01
IGL02706:Fryl APN 5 73,250,506 (GRCm39) missense probably benign 0.45
IGL03022:Fryl APN 5 73,216,726 (GRCm39) missense possibly damaging 0.82
IGL03144:Fryl APN 5 73,258,798 (GRCm39) missense probably null 0.22
IGL03155:Fryl APN 5 73,234,038 (GRCm39) missense probably benign
IGL03183:Fryl APN 5 73,234,038 (GRCm39) missense probably benign
IGL03275:Fryl APN 5 73,305,376 (GRCm39) missense possibly damaging 0.47
IGL03310:Fryl APN 5 73,293,659 (GRCm39) splice site probably benign
IGL03341:Fryl APN 5 73,234,038 (GRCm39) missense probably benign
IGL03343:Fryl APN 5 73,234,038 (GRCm39) missense probably benign
IGL03350:Fryl APN 5 73,290,649 (GRCm39) missense probably damaging 0.99
IGL03357:Fryl APN 5 73,211,402 (GRCm39) missense probably damaging 1.00
IGL03374:Fryl APN 5 73,267,624 (GRCm39) splice site probably benign
IGL03375:Fryl APN 5 73,245,792 (GRCm39) missense possibly damaging 0.91
bedeviled UTSW 5 73,216,843 (GRCm39) missense probably damaging 1.00
Besotted UTSW 5 73,230,255 (GRCm39) missense probably damaging 1.00
R0062:Fryl UTSW 5 73,179,621 (GRCm39) missense probably benign 0.02
R0062:Fryl UTSW 5 73,179,621 (GRCm39) missense probably benign 0.02
R0308:Fryl UTSW 5 73,198,947 (GRCm39) splice site probably benign
R0312:Fryl UTSW 5 73,230,231 (GRCm39) missense probably damaging 1.00
R0415:Fryl UTSW 5 73,255,757 (GRCm39) missense probably damaging 0.99
R0440:Fryl UTSW 5 73,244,315 (GRCm39) missense possibly damaging 0.91
R0446:Fryl UTSW 5 73,254,760 (GRCm39) missense possibly damaging 0.91
R0566:Fryl UTSW 5 73,221,840 (GRCm39) splice site probably benign
R0567:Fryl UTSW 5 73,222,734 (GRCm39) missense possibly damaging 0.50
R0606:Fryl UTSW 5 73,282,077 (GRCm39) missense probably benign 0.15
R0619:Fryl UTSW 5 73,226,074 (GRCm39) missense probably benign 0.22
R0654:Fryl UTSW 5 73,240,715 (GRCm39) missense probably benign 0.17
R0658:Fryl UTSW 5 73,222,702 (GRCm39) missense probably damaging 1.00
R0707:Fryl UTSW 5 73,240,715 (GRCm39) missense probably benign 0.17
R0744:Fryl UTSW 5 73,246,424 (GRCm39) unclassified probably benign
R0745:Fryl UTSW 5 73,228,469 (GRCm39) missense probably damaging 0.96
R0833:Fryl UTSW 5 73,246,424 (GRCm39) unclassified probably benign
R0885:Fryl UTSW 5 73,246,539 (GRCm39) missense probably damaging 0.97
R0894:Fryl UTSW 5 73,198,675 (GRCm39) splice site probably benign
R1076:Fryl UTSW 5 73,282,016 (GRCm39) unclassified probably benign
R1241:Fryl UTSW 5 73,267,614 (GRCm39) missense probably damaging 1.00
R1241:Fryl UTSW 5 73,222,268 (GRCm39) splice site probably benign
R1394:Fryl UTSW 5 73,230,255 (GRCm39) missense probably damaging 1.00
R1395:Fryl UTSW 5 73,230,255 (GRCm39) missense probably damaging 1.00
R1608:Fryl UTSW 5 73,232,094 (GRCm39) nonsense probably null
R1664:Fryl UTSW 5 73,216,778 (GRCm39) missense probably damaging 1.00
R1745:Fryl UTSW 5 73,190,204 (GRCm39) splice site probably benign
R1969:Fryl UTSW 5 73,255,609 (GRCm39) missense probably benign 0.18
R1993:Fryl UTSW 5 73,265,836 (GRCm39) missense probably damaging 1.00
R1994:Fryl UTSW 5 73,265,836 (GRCm39) missense probably damaging 1.00
R2029:Fryl UTSW 5 73,179,465 (GRCm39) nonsense probably null
R2036:Fryl UTSW 5 73,265,305 (GRCm39) critical splice donor site probably null
R2036:Fryl UTSW 5 73,179,887 (GRCm39) missense probably benign
R2088:Fryl UTSW 5 73,222,804 (GRCm39) missense probably benign 0.02
R2105:Fryl UTSW 5 73,279,642 (GRCm39) missense probably benign
R2106:Fryl UTSW 5 73,255,674 (GRCm39) missense probably damaging 1.00
R2186:Fryl UTSW 5 73,222,318 (GRCm39) missense probably damaging 1.00
R2239:Fryl UTSW 5 73,265,890 (GRCm39) missense probably damaging 0.99
R2256:Fryl UTSW 5 73,230,187 (GRCm39) missense possibly damaging 0.47
R2257:Fryl UTSW 5 73,230,187 (GRCm39) missense possibly damaging 0.47
R2280:Fryl UTSW 5 73,198,707 (GRCm39) missense possibly damaging 0.47
R2281:Fryl UTSW 5 73,198,707 (GRCm39) missense possibly damaging 0.47
R2911:Fryl UTSW 5 73,207,799 (GRCm39) missense probably damaging 0.99
R3019:Fryl UTSW 5 73,240,193 (GRCm39) missense probably benign 0.01
R3416:Fryl UTSW 5 73,265,417 (GRCm39) missense possibly damaging 0.84
R3783:Fryl UTSW 5 73,258,819 (GRCm39) missense probably benign
R3787:Fryl UTSW 5 73,258,819 (GRCm39) missense probably benign
R3837:Fryl UTSW 5 73,228,608 (GRCm39) missense probably benign 0.03
R3969:Fryl UTSW 5 73,269,766 (GRCm39) missense probably damaging 0.97
R4387:Fryl UTSW 5 73,243,903 (GRCm39) missense possibly damaging 0.91
R4502:Fryl UTSW 5 73,245,740 (GRCm39) missense probably damaging 1.00
R4658:Fryl UTSW 5 73,238,396 (GRCm39) missense probably damaging 1.00
R4664:Fryl UTSW 5 73,248,022 (GRCm39) missense possibly damaging 0.80
R4690:Fryl UTSW 5 73,257,636 (GRCm39) missense probably benign
R4700:Fryl UTSW 5 73,222,881 (GRCm39) missense possibly damaging 0.88
R4709:Fryl UTSW 5 73,238,315 (GRCm39) missense probably benign 0.03
R4807:Fryl UTSW 5 73,198,705 (GRCm39) missense probably benign 0.00
R4912:Fryl UTSW 5 73,226,125 (GRCm39) frame shift probably null
R4948:Fryl UTSW 5 73,246,473 (GRCm39) missense probably benign 0.08
R4959:Fryl UTSW 5 73,192,401 (GRCm39) missense probably benign 0.00
R5062:Fryl UTSW 5 73,233,236 (GRCm39) missense possibly damaging 0.89
R5067:Fryl UTSW 5 73,215,098 (GRCm39) missense probably benign 0.13
R5071:Fryl UTSW 5 73,232,110 (GRCm39) missense probably damaging 0.99
R5072:Fryl UTSW 5 73,232,110 (GRCm39) missense probably damaging 0.99
R5073:Fryl UTSW 5 73,232,110 (GRCm39) missense probably damaging 0.99
R5074:Fryl UTSW 5 73,232,110 (GRCm39) missense probably damaging 0.99
R5139:Fryl UTSW 5 73,248,061 (GRCm39) missense probably damaging 1.00
R5172:Fryl UTSW 5 73,259,016 (GRCm39) missense possibly damaging 0.95
R5187:Fryl UTSW 5 73,243,943 (GRCm39) missense possibly damaging 0.95
R5272:Fryl UTSW 5 73,222,479 (GRCm39) nonsense probably null
R5275:Fryl UTSW 5 73,270,134 (GRCm39) missense probably damaging 1.00
R5295:Fryl UTSW 5 73,270,134 (GRCm39) missense probably damaging 1.00
R5344:Fryl UTSW 5 73,262,117 (GRCm39) missense probably damaging 1.00
R5355:Fryl UTSW 5 73,231,247 (GRCm39) missense probably damaging 1.00
R5716:Fryl UTSW 5 73,257,808 (GRCm39) missense probably benign
R5778:Fryl UTSW 5 73,230,121 (GRCm39) missense probably damaging 1.00
R5810:Fryl UTSW 5 73,248,098 (GRCm39) missense probably benign 0.06
R5934:Fryl UTSW 5 73,248,060 (GRCm39) missense probably damaging 1.00
R5948:Fryl UTSW 5 73,254,715 (GRCm39) critical splice donor site probably null
R6005:Fryl UTSW 5 73,240,638 (GRCm39) missense probably damaging 1.00
R6026:Fryl UTSW 5 73,257,340 (GRCm39) missense probably benign 0.04
R6045:Fryl UTSW 5 73,275,894 (GRCm39) missense probably damaging 0.99
R6185:Fryl UTSW 5 73,270,131 (GRCm39) missense probably benign 0.43
R6247:Fryl UTSW 5 73,222,824 (GRCm39) missense probably damaging 0.98
R6294:Fryl UTSW 5 73,349,102 (GRCm39) intron probably benign
R6310:Fryl UTSW 5 73,349,104 (GRCm39) intron probably benign
R6429:Fryl UTSW 5 73,248,094 (GRCm39) missense possibly damaging 0.84
R6568:Fryl UTSW 5 73,216,859 (GRCm39) missense probably damaging 1.00
R6636:Fryl UTSW 5 73,290,655 (GRCm39) missense probably benign 0.01
R6664:Fryl UTSW 5 73,289,824 (GRCm39) missense probably damaging 1.00
R6732:Fryl UTSW 5 73,212,124 (GRCm39) missense probably damaging 1.00
R6750:Fryl UTSW 5 73,179,575 (GRCm39) missense probably damaging 1.00
R6805:Fryl UTSW 5 73,222,437 (GRCm39) missense probably benign 0.03
R6823:Fryl UTSW 5 73,222,560 (GRCm39) missense probably damaging 0.99
R6855:Fryl UTSW 5 73,216,843 (GRCm39) missense probably damaging 1.00
R6858:Fryl UTSW 5 73,222,375 (GRCm39) missense probably damaging 1.00
R6868:Fryl UTSW 5 73,226,146 (GRCm39) missense probably damaging 1.00
R6898:Fryl UTSW 5 73,179,485 (GRCm39) missense probably damaging 0.96
R6908:Fryl UTSW 5 73,179,554 (GRCm39) missense probably damaging 1.00
R6958:Fryl UTSW 5 73,231,272 (GRCm39) missense possibly damaging 0.89
R6980:Fryl UTSW 5 73,207,773 (GRCm39) missense probably benign 0.06
R7036:Fryl UTSW 5 73,212,951 (GRCm39) missense probably benign 0.03
R7065:Fryl UTSW 5 73,248,099 (GRCm39) missense probably damaging 0.96
R7097:Fryl UTSW 5 73,231,251 (GRCm39) missense probably benign 0.31
R7171:Fryl UTSW 5 73,279,653 (GRCm39) missense probably damaging 0.97
R7191:Fryl UTSW 5 73,230,255 (GRCm39) missense probably damaging 1.00
R7207:Fryl UTSW 5 73,222,438 (GRCm39) missense probably benign
R7236:Fryl UTSW 5 73,265,821 (GRCm39) missense possibly damaging 0.66
R7334:Fryl UTSW 5 73,204,839 (GRCm39) splice site probably null
R7425:Fryl UTSW 5 73,262,091 (GRCm39) missense probably damaging 1.00
R7452:Fryl UTSW 5 73,181,331 (GRCm39) missense probably damaging 1.00
R7479:Fryl UTSW 5 73,254,904 (GRCm39) missense possibly damaging 0.71
R7535:Fryl UTSW 5 73,255,539 (GRCm39) missense probably benign 0.15
R7538:Fryl UTSW 5 73,180,019 (GRCm39) missense probably benign 0.09
R7544:Fryl UTSW 5 73,238,382 (GRCm39) missense probably benign
R7548:Fryl UTSW 5 73,349,105 (GRCm39) missense unknown
R7565:Fryl UTSW 5 73,191,063 (GRCm39) missense probably benign 0.18
R7572:Fryl UTSW 5 73,245,739 (GRCm39) missense possibly damaging 0.91
R7582:Fryl UTSW 5 73,179,843 (GRCm39) critical splice donor site probably null
R7630:Fryl UTSW 5 73,267,588 (GRCm39) missense possibly damaging 0.62
R7774:Fryl UTSW 5 73,240,727 (GRCm39) missense probably benign 0.12
R7777:Fryl UTSW 5 73,228,641 (GRCm39) missense probably damaging 0.98
R7917:Fryl UTSW 5 73,211,875 (GRCm39) missense probably damaging 1.00
R7920:Fryl UTSW 5 73,259,150 (GRCm39) splice site probably null
R8110:Fryl UTSW 5 73,290,620 (GRCm39) missense probably benign 0.10
R8120:Fryl UTSW 5 73,228,527 (GRCm39) missense probably benign 0.01
R8143:Fryl UTSW 5 73,207,682 (GRCm39) missense probably benign 0.00
R8207:Fryl UTSW 5 73,257,843 (GRCm39) splice site probably null
R8263:Fryl UTSW 5 73,238,348 (GRCm39) missense probably damaging 1.00
R8350:Fryl UTSW 5 73,226,073 (GRCm39) missense probably benign
R8359:Fryl UTSW 5 73,233,276 (GRCm39) missense probably benign 0.39
R8387:Fryl UTSW 5 73,293,663 (GRCm39) critical splice donor site probably null
R8403:Fryl UTSW 5 73,275,790 (GRCm39) makesense probably null
R8450:Fryl UTSW 5 73,226,073 (GRCm39) missense probably benign
R8514:Fryl UTSW 5 73,242,699 (GRCm39) missense probably benign
R8536:Fryl UTSW 5 73,257,696 (GRCm39) missense probably damaging 0.99
R8703:Fryl UTSW 5 73,247,997 (GRCm39) missense probably damaging 0.99
R8708:Fryl UTSW 5 73,289,905 (GRCm39) missense probably benign 0.01
R8783:Fryl UTSW 5 73,226,185 (GRCm39) missense probably benign 0.45
R9028:Fryl UTSW 5 73,255,609 (GRCm39) missense probably benign 0.18
R9045:Fryl UTSW 5 73,182,118 (GRCm39) missense
R9063:Fryl UTSW 5 73,238,346 (GRCm39) missense possibly damaging 0.70
R9096:Fryl UTSW 5 73,265,920 (GRCm39) missense probably benign 0.01
R9244:Fryl UTSW 5 73,348,862 (GRCm39) intron probably benign
R9345:Fryl UTSW 5 73,207,754 (GRCm39) missense probably benign
R9381:Fryl UTSW 5 73,240,637 (GRCm39) missense probably benign 0.24
R9386:Fryl UTSW 5 73,349,152 (GRCm39) missense unknown
R9401:Fryl UTSW 5 73,222,563 (GRCm39) nonsense probably null
R9497:Fryl UTSW 5 73,215,134 (GRCm39) missense
R9514:Fryl UTSW 5 73,262,115 (GRCm39) missense probably damaging 1.00
R9570:Fryl UTSW 5 73,179,498 (GRCm39) missense probably benign 0.02
R9654:Fryl UTSW 5 73,275,801 (GRCm39) missense probably benign
R9665:Fryl UTSW 5 73,222,299 (GRCm39) missense probably damaging 1.00
R9685:Fryl UTSW 5 73,216,879 (GRCm39) missense probably damaging 0.99
R9798:Fryl UTSW 5 73,192,402 (GRCm39) missense probably benign
Z1088:Fryl UTSW 5 73,248,081 (GRCm39) missense probably damaging 1.00
Z1088:Fryl UTSW 5 73,248,052 (GRCm39) missense probably damaging 0.99
Z1176:Fryl UTSW 5 73,230,180 (GRCm39) missense probably benign
Z1177:Fryl UTSW 5 73,198,938 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TCGGCTTGATAACACCATCAC -3'
(R):5'- TAGTTGCGACTAAAGCCCCAG -3'

Sequencing Primer
(F):5'- TTGATAACACCATCACCCCATCG -3'
(R):5'- CAGCTGATTTTATTTCATTACATGGC -3'
Posted On 2014-07-14