Incidental Mutation 'R1937:Nphs1'
ID 213544
Institutional Source Beutler Lab
Gene Symbol Nphs1
Ensembl Gene ENSMUSG00000006649
Gene Name nephrosis 1, nephrin
Synonyms nephrin
MMRRC Submission 039955-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1937 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 30157740-30186648 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 30173798 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 985 (Q985L)
Ref Sequence ENSEMBL: ENSMUSP00000006825 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006825] [ENSMUST00000126297]
AlphaFold Q9QZS7
Predicted Effect probably damaging
Transcript: ENSMUST00000006825
AA Change: Q985L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000006825
Gene: ENSMUSG00000006649
AA Change: Q985L

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
IG 52 146 1.38e-6 SMART
Pfam:C2-set_2 152 242 4.1e-20 PFAM
IG 264 351 9.86e-3 SMART
IG_like 360 452 2.73e1 SMART
IG 464 556 2.99e-2 SMART
IG_like 572 644 8.9e-1 SMART
IG 667 751 1.32e-3 SMART
IG 760 849 7.3e-6 SMART
IGc2 868 941 5.4e-9 SMART
FN3 955 1036 1.01e-11 SMART
transmembrane domain 1078 1100 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123880
Predicted Effect probably damaging
Transcript: ENSMUST00000126297
AA Change: Q971L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000116500
Gene: ENSMUSG00000006649
AA Change: Q971L

DomainStartEndE-ValueType
IG 38 132 1.38e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149086
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.7%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the immunoglobulin family of cell adhesion molecules that functions in the glomerular filtration barrier in the kidney. The gene is primarily expressed in renal tissues, and the protein is a type-1 transmembrane protein found at the slit diaphragm of glomerular podocytes. The slit diaphragm is thought to function as an ultrafilter to exclude albumin and other plasma macromolecules in the formation of urine. Mutations in this gene result in Finnish-type congenital nephrosis 1, characterized by severe proteinuria and loss of the slit diaphragm and foot processes.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit severe proteinuria associated with kidney defects and die soon after birth. Heterozygotes exhibit fusion of one-third of glomerular foot processes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730480H06Rik C A 5: 48,531,777 (GRCm39) T35K probably benign Het
Abhd14a A G 9: 106,317,446 (GRCm39) probably benign Het
Abhd8 A G 8: 71,914,506 (GRCm39) F41L possibly damaging Het
Ace2 A T X: 162,939,524 (GRCm39) M123L possibly damaging Het
Actr5 T C 2: 158,477,949 (GRCm39) Y440H possibly damaging Het
Akr1c6 T A 13: 4,496,383 (GRCm39) N81K probably benign Het
Aqp11 T A 7: 97,386,725 (GRCm39) N157I possibly damaging Het
Arhgap10 T C 8: 78,071,282 (GRCm39) E568G probably damaging Het
Asb7 T A 7: 66,329,001 (GRCm39) Q13L probably benign Het
Atf7ip C A 6: 136,537,778 (GRCm39) A345E probably benign Het
Atp8a2 T C 14: 60,097,719 (GRCm39) K770E probably benign Het
Bpifb4 A T 2: 153,785,996 (GRCm39) I259F probably damaging Het
Cand1 A T 10: 119,038,925 (GRCm39) D1218E probably damaging Het
Capg A G 6: 72,535,236 (GRCm39) probably null Het
Cep290 C T 10: 100,333,815 (GRCm39) T289M possibly damaging Het
Cfap69 T C 5: 5,643,818 (GRCm39) Y548C probably damaging Het
Cfap97d1 A T 11: 101,877,989 (GRCm39) H17L probably damaging Het
Cimip2b T A 4: 43,427,586 (GRCm39) K220N probably damaging Het
Clock A G 5: 76,377,340 (GRCm39) L652P probably damaging Het
Col3a1 C T 1: 45,373,453 (GRCm39) probably benign Het
Coro7 T C 16: 4,446,596 (GRCm39) E843G probably benign Het
Crebrf T C 17: 26,961,442 (GRCm39) S188P probably damaging Het
Crppa G A 12: 36,440,367 (GRCm39) V92I probably benign Het
Cul1 T C 6: 47,485,289 (GRCm39) F307L probably benign Het
Cyb561d2 G A 9: 107,417,515 (GRCm39) R79W probably damaging Het
Cyp3a59 T C 5: 146,031,187 (GRCm39) S117P possibly damaging Het
Ddias A G 7: 92,507,830 (GRCm39) I695T probably benign Het
Dhx29 G A 13: 113,101,864 (GRCm39) G1311D probably benign Het
Dync2h1 A G 9: 7,139,159 (GRCm39) probably null Het
Ece2 T A 16: 20,436,616 (GRCm39) V146E probably damaging Het
Eml2 A G 7: 18,937,889 (GRCm39) K586E possibly damaging Het
Eps8l3 A G 3: 107,791,708 (GRCm39) E316G probably benign Het
Fam135b A T 15: 71,493,863 (GRCm39) L22H probably damaging Het
Focad T A 4: 88,319,318 (GRCm39) M1K probably null Het
Fryl A G 5: 73,290,710 (GRCm39) S65P probably damaging Het
Gm14190 C T 11: 99,581,556 (GRCm39) C4Y unknown Het
H2-T5 T A 17: 36,478,899 (GRCm39) T117S probably damaging Het
Ift74 T A 4: 94,550,883 (GRCm39) M345K probably benign Het
Jag1 C G 2: 136,925,393 (GRCm39) V1070L possibly damaging Het
Kcng1 T C 2: 168,104,941 (GRCm39) T302A probably benign Het
Kif20b T C 19: 34,930,278 (GRCm39) V1221A possibly damaging Het
Kif23 A T 9: 61,853,892 (GRCm39) probably null Het
Lpxn T G 19: 12,802,274 (GRCm39) S200A probably benign Het
Meiob A G 17: 25,037,305 (GRCm39) H61R probably benign Het
Mfhas1 C T 8: 36,056,799 (GRCm39) L425F probably damaging Het
Myo3a A T 2: 22,401,126 (GRCm39) S632C probably damaging Het
Naip2 T C 13: 100,298,362 (GRCm39) E558G probably benign Het
Naip2 C T 13: 100,298,368 (GRCm39) G556D probably benign Het
Nbeal1 T A 1: 60,307,100 (GRCm39) Y374* probably null Het
Notch3 T C 17: 32,372,826 (GRCm39) S582G probably benign Het
Oas1c T A 5: 120,941,049 (GRCm39) H248L probably benign Het
Or5c1 A T 2: 37,221,896 (GRCm39) N46Y probably damaging Het
Or5g26 T C 2: 85,494,341 (GRCm39) I146V probably benign Het
Or5h25 A T 16: 58,930,157 (GRCm39) M272K probably benign Het
Or8g35 A G 9: 39,381,333 (GRCm39) S230P possibly damaging Het
Pamr1 A T 2: 102,472,617 (GRCm39) I639F possibly damaging Het
Panx1 G T 9: 14,918,980 (GRCm39) T293K possibly damaging Het
Papss1 G T 3: 131,305,632 (GRCm39) V226F probably benign Het
Pax1 G T 2: 147,209,809 (GRCm39) G301V possibly damaging Het
Pdlim5 C A 3: 141,950,742 (GRCm39) R557L possibly damaging Het
Pdyn C A 2: 129,531,729 (GRCm39) M20I probably benign Het
Pelp1 G A 11: 70,284,541 (GRCm39) probably null Het
Pkd2 T C 5: 104,626,790 (GRCm39) V324A probably damaging Het
Pkdrej A G 15: 85,703,368 (GRCm39) I856T probably benign Het
Polr1a T C 6: 71,913,536 (GRCm39) probably null Het
Pot1a A T 6: 25,753,323 (GRCm39) D404E probably benign Het
Ppp2r2a A T 14: 67,253,878 (GRCm39) I430N possibly damaging Het
Prob1 C T 18: 35,787,279 (GRCm39) R325Q possibly damaging Het
Prrc2a T C 17: 35,376,884 (GRCm39) D742G probably damaging Het
Psmc1 C T 12: 100,081,102 (GRCm39) P54S probably benign Het
Rab22a A G 2: 173,530,004 (GRCm39) T61A probably damaging Het
Rims1 T A 1: 22,358,754 (GRCm39) K184N probably damaging Het
Rnf213 G A 11: 119,322,511 (GRCm39) R1376H probably damaging Het
Ryr2 T C 13: 11,683,848 (GRCm39) E3072G probably damaging Het
Serpina1b T C 12: 103,698,420 (GRCm39) K143R probably benign Het
Slc22a15 T G 3: 101,787,505 (GRCm39) probably null Het
Slc25a14 G A X: 47,740,840 (GRCm39) V210I probably benign Het
Slc25a48 A C 13: 56,596,811 (GRCm39) T31P probably damaging Het
Slc9a3 C T 13: 74,314,175 (GRCm39) probably null Het
Slx4 T C 16: 3,805,030 (GRCm39) *105W probably null Het
Smc6 A G 12: 11,349,399 (GRCm39) N794S probably benign Het
Spata18 G A 5: 73,834,307 (GRCm39) R387Q probably damaging Het
Sphkap C A 1: 83,245,162 (GRCm39) E1486* probably null Het
Srsf6 C T 2: 162,776,403 (GRCm39) probably benign Het
St8sia1 C T 6: 142,909,398 (GRCm39) A33T probably damaging Het
Tet2 T C 3: 133,194,399 (GRCm39) T12A possibly damaging Het
Tmem144 G T 3: 79,732,611 (GRCm39) S222R probably damaging Het
Tnrc6c A G 11: 117,646,849 (GRCm39) D1450G possibly damaging Het
Top1 A T 2: 160,512,042 (GRCm39) K27N unknown Het
Tox2 A G 2: 163,067,476 (GRCm39) H30R probably benign Het
Tra2b T C 16: 22,065,993 (GRCm39) probably benign Het
Trio A T 15: 27,833,142 (GRCm39) V1165E probably damaging Het
Troap T A 15: 98,975,269 (GRCm39) S145R probably damaging Het
Ttc34 G A 4: 154,950,139 (GRCm39) A1031T possibly damaging Het
Ttc6 C T 12: 57,663,109 (GRCm39) P302S probably benign Het
Ubiad1 A G 4: 148,528,468 (GRCm39) L147P probably damaging Het
Ugt2b35 G T 5: 87,149,141 (GRCm39) V131F probably damaging Het
Utp25 A T 1: 192,804,401 (GRCm39) D200E probably damaging Het
Vmn1r167 G A 7: 23,204,452 (GRCm39) T188I probably benign Het
Vmn1r46 G T 6: 89,953,716 (GRCm39) M188I probably benign Het
Vmn2r115 T A 17: 23,578,388 (GRCm39) N620K probably damaging Het
Vmn2r66 A G 7: 84,644,344 (GRCm39) S689P probably damaging Het
Wipf2 C T 11: 98,783,236 (GRCm39) R221* probably null Het
Zbtb16 T C 9: 48,571,078 (GRCm39) S563G probably benign Het
Zfp319 T C 8: 96,055,199 (GRCm39) T335A probably damaging Het
Zfp418 A G 7: 7,185,401 (GRCm39) R455G possibly damaging Het
Other mutations in Nphs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Nphs1 APN 7 30,181,976 (GRCm39) missense possibly damaging 0.77
IGL00927:Nphs1 APN 7 30,160,164 (GRCm39) unclassified probably benign
IGL00976:Nphs1 APN 7 30,160,110 (GRCm39) missense possibly damaging 0.78
IGL01397:Nphs1 APN 7 30,186,089 (GRCm39) missense probably benign 0.01
IGL01465:Nphs1 APN 7 30,186,139 (GRCm39) makesense probably null
IGL01889:Nphs1 APN 7 30,159,936 (GRCm39) missense probably damaging 1.00
IGL02383:Nphs1 APN 7 30,181,060 (GRCm39) splice site probably benign
R0020:Nphs1 UTSW 7 30,162,633 (GRCm39) missense probably benign 0.01
R0485:Nphs1 UTSW 7 30,166,940 (GRCm39) missense probably benign
R1024:Nphs1 UTSW 7 30,173,702 (GRCm39) missense probably damaging 1.00
R1115:Nphs1 UTSW 7 30,180,803 (GRCm39) splice site probably benign
R1144:Nphs1 UTSW 7 30,181,103 (GRCm39) splice site probably benign
R1289:Nphs1 UTSW 7 30,170,603 (GRCm39) missense probably damaging 1.00
R1317:Nphs1 UTSW 7 30,181,256 (GRCm39) splice site probably benign
R1617:Nphs1 UTSW 7 30,181,956 (GRCm39) missense probably benign
R1756:Nphs1 UTSW 7 30,160,959 (GRCm39) missense probably benign 0.00
R2144:Nphs1 UTSW 7 30,160,395 (GRCm39) missense probably benign 0.13
R2256:Nphs1 UTSW 7 30,167,417 (GRCm39) missense possibly damaging 0.94
R2257:Nphs1 UTSW 7 30,167,417 (GRCm39) missense possibly damaging 0.94
R2277:Nphs1 UTSW 7 30,166,989 (GRCm39) nonsense probably null
R3104:Nphs1 UTSW 7 30,166,965 (GRCm39) nonsense probably null
R3106:Nphs1 UTSW 7 30,166,965 (GRCm39) nonsense probably null
R3151:Nphs1 UTSW 7 30,159,665 (GRCm39) missense probably benign
R3765:Nphs1 UTSW 7 30,170,635 (GRCm39) missense probably damaging 0.98
R4078:Nphs1 UTSW 7 30,166,945 (GRCm39) nonsense probably null
R4397:Nphs1 UTSW 7 30,181,390 (GRCm39) splice site probably null
R4635:Nphs1 UTSW 7 30,167,432 (GRCm39) missense probably benign 0.39
R4650:Nphs1 UTSW 7 30,181,895 (GRCm39) missense probably benign 0.21
R4811:Nphs1 UTSW 7 30,159,854 (GRCm39) missense probably damaging 1.00
R4850:Nphs1 UTSW 7 30,162,657 (GRCm39) missense possibly damaging 0.78
R5272:Nphs1 UTSW 7 30,181,067 (GRCm39) missense possibly damaging 0.86
R5327:Nphs1 UTSW 7 30,163,250 (GRCm39) missense probably benign 0.00
R5681:Nphs1 UTSW 7 30,186,050 (GRCm39) missense probably benign 0.00
R5865:Nphs1 UTSW 7 30,173,810 (GRCm39) missense probably damaging 1.00
R5975:Nphs1 UTSW 7 30,165,540 (GRCm39) missense possibly damaging 0.82
R6186:Nphs1 UTSW 7 30,165,059 (GRCm39) missense probably damaging 0.98
R6198:Nphs1 UTSW 7 30,167,340 (GRCm39) missense probably damaging 0.97
R6353:Nphs1 UTSW 7 30,173,969 (GRCm39) missense probably damaging 0.99
R7405:Nphs1 UTSW 7 30,162,253 (GRCm39) missense possibly damaging 0.46
R7647:Nphs1 UTSW 7 30,181,390 (GRCm39) splice site probably null
R7767:Nphs1 UTSW 7 30,162,733 (GRCm39) missense probably damaging 1.00
R8132:Nphs1 UTSW 7 30,181,478 (GRCm39) missense probably benign 0.02
R8485:Nphs1 UTSW 7 30,165,598 (GRCm39) missense probably damaging 0.98
R8678:Nphs1 UTSW 7 30,163,284 (GRCm39) missense probably damaging 1.00
R8890:Nphs1 UTSW 7 30,162,080 (GRCm39) missense probably damaging 1.00
R8946:Nphs1 UTSW 7 30,162,625 (GRCm39) missense probably damaging 1.00
R9133:Nphs1 UTSW 7 30,160,092 (GRCm39) nonsense probably null
R9159:Nphs1 UTSW 7 30,165,026 (GRCm39) missense possibly damaging 0.93
R9347:Nphs1 UTSW 7 30,170,594 (GRCm39) missense probably damaging 1.00
R9547:Nphs1 UTSW 7 30,180,875 (GRCm39) missense probably benign 0.00
R9548:Nphs1 UTSW 7 30,180,875 (GRCm39) missense probably benign 0.00
R9607:Nphs1 UTSW 7 30,163,012 (GRCm39) missense probably damaging 1.00
R9626:Nphs1 UTSW 7 30,166,991 (GRCm39) missense probably benign 0.16
R9720:Nphs1 UTSW 7 30,165,499 (GRCm39) missense possibly damaging 0.83
R9733:Nphs1 UTSW 7 30,166,955 (GRCm39) missense probably damaging 1.00
X0028:Nphs1 UTSW 7 30,166,929 (GRCm39) missense probably null 0.01
Z1177:Nphs1 UTSW 7 30,170,328 (GRCm39) missense probably damaging 1.00
Z1186:Nphs1 UTSW 7 30,159,775 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAACTCATTGAGCACAGCC -3'
(R):5'- CTTCAGCCCAGTCAGTGTGAAG -3'

Sequencing Primer
(F):5'- GAGAACCAACCACTGTTCTCAGGAG -3'
(R):5'- CCAGTCAGTGTGAAGGTGGTG -3'
Posted On 2014-07-14