Incidental Mutation 'R1937:Rnf213'
ID213571
Institutional Source Beutler Lab
Gene Symbol Rnf213
Ensembl Gene ENSMUSG00000070327
Gene Namering finger protein 213
SynonymsD11Ertd759e
MMRRC Submission 039955-MU
Accession Numbers

Genbank: XM_001477846.2; Ensembl: ENSMUST00000131035, ENSMUST00000082107, ENSMUST00000093902, ENSMUST00000169768, ENSMUST00000172235

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1937 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location119393100-119487418 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 119431685 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 1376 (R1376H)
Ref Sequence ENSEMBL: ENSMUSP00000115063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093902] [ENSMUST00000131035]
Predicted Effect probably damaging
Transcript: ENSMUST00000093902
AA Change: R1377H

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000091429
Gene: ENSMUSG00000070327
AA Change: R1377H

DomainStartEndE-ValueType
low complexity region 130 146 N/A INTRINSIC
low complexity region 265 279 N/A INTRINSIC
low complexity region 319 335 N/A INTRINSIC
low complexity region 676 688 N/A INTRINSIC
low complexity region 1114 1128 N/A INTRINSIC
low complexity region 1546 1558 N/A INTRINSIC
AAA 2373 2515 2.82e-2 SMART
AAA 2722 2890 3.63e-1 SMART
low complexity region 3449 3459 N/A INTRINSIC
RING 3947 3985 8.69e-5 SMART
Blast:PP2Ac 4544 4722 3e-66 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000131035
AA Change: R1376H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115063
Gene: ENSMUSG00000070327
AA Change: R1376H

DomainStartEndE-ValueType
low complexity region 130 146 N/A INTRINSIC
low complexity region 265 279 N/A INTRINSIC
low complexity region 319 335 N/A INTRINSIC
low complexity region 676 688 N/A INTRINSIC
low complexity region 1113 1127 N/A INTRINSIC
low complexity region 1545 1557 N/A INTRINSIC
AAA 2372 2514 2.82e-2 SMART
AAA 2721 2889 3.63e-1 SMART
low complexity region 3448 3458 N/A INTRINSIC
RING 3946 3984 8.69e-5 SMART
Blast:PP2Ac 4542 4720 3e-66 BLAST
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.7%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a C3HC4-type RING finger domain, which is a specialized type of Zn-finger that binds two atoms of zinc and is thought to be involved in mediating protein-protein interactions. The protein also contains an AAA domain, which is associated with ATPase activity. This gene is a susceptibility gene for Moyamoya disease, a vascular disorder of intracranial arteries. This gene is also a translocation partner in anaplastic large cell lymphoma and inflammatory myofibroblastic tumor cases, where a t(2;17)(p23;q25) translocation has been identified with the anaplastic lymphoma kinase (ALK) gene on chromosome 2, and a t(8;17)(q24;q25) translocation has been identified with the MYC gene on chromosome 8. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body weight and circulating glucose level but normal glucose tolerance, insulin sensitivity, insulin plasma levels and leptin plasma levels. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted, other(2) Gene trapped(11)

Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006E09Rik A T 11: 101,987,163 H17L probably damaging Het
5730480H06Rik C A 5: 48,374,435 T35K probably benign Het
Abhd14a A G 9: 106,440,247 probably benign Het
Abhd8 A G 8: 71,461,862 F41L possibly damaging Het
Ace2 A T X: 164,156,528 M123L possibly damaging Het
Actr5 T C 2: 158,636,029 Y440H possibly damaging Het
Akr1c6 T A 13: 4,446,384 N81K probably benign Het
Aqp11 T A 7: 97,737,518 N157I possibly damaging Het
Arhgap10 T C 8: 77,344,653 E568G probably damaging Het
Asb7 T A 7: 66,679,253 Q13L probably benign Het
Atf7ip C A 6: 136,560,780 A345E probably benign Het
Atp8a2 T C 14: 59,860,270 K770E probably benign Het
Bpifb4 A T 2: 153,944,076 I259F probably damaging Het
Cand1 A T 10: 119,203,020 D1218E probably damaging Het
Capg A G 6: 72,558,253 probably null Het
Cep290 C T 10: 100,497,953 T289M possibly damaging Het
Cfap69 T C 5: 5,593,818 Y548C probably damaging Het
Clock A G 5: 76,229,493 L652P probably damaging Het
Col3a1 C T 1: 45,334,293 probably benign Het
Coro7 T C 16: 4,628,732 E843G probably benign Het
Crebrf T C 17: 26,742,468 S188P probably damaging Het
Cul1 T C 6: 47,508,355 F307L probably benign Het
Cyb561d2 G A 9: 107,540,316 R79W probably damaging Het
Cyp3a59 T C 5: 146,094,377 S117P possibly damaging Het
Ddias A G 7: 92,858,622 I695T probably benign Het
Dhx29 G A 13: 112,965,330 G1311D probably benign Het
Diexf A T 1: 193,122,093 D200E probably damaging Het
Dync2h1 A G 9: 7,139,159 probably null Het
Ece2 T A 16: 20,617,866 V146E probably damaging Het
Eml2 A G 7: 19,203,964 K586E possibly damaging Het
Eps8l3 A G 3: 107,884,392 E316G probably benign Het
Fam135b A T 15: 71,622,014 L22H probably damaging Het
Fam166b T A 4: 43,427,586 K220N probably damaging Het
Focad T A 4: 88,401,081 M1K probably null Het
Fryl A G 5: 73,133,367 S65P probably damaging Het
Gm14190 C T 11: 99,690,730 C4Y unknown Het
Gm8909 T A 17: 36,168,007 T117S probably damaging Het
Ift74 T A 4: 94,662,646 M345K probably benign Het
Ispd G A 12: 36,390,368 V92I probably benign Het
Jag1 C G 2: 137,083,473 V1070L possibly damaging Het
Kcng1 T C 2: 168,263,021 T302A probably benign Het
Kif20b T C 19: 34,952,878 V1221A possibly damaging Het
Kif23 A T 9: 61,946,610 probably null Het
Lpxn T G 19: 12,824,910 S200A probably benign Het
Meiob A G 17: 24,818,331 H61R probably benign Het
Mfhas1 C T 8: 35,589,645 L425F probably damaging Het
Myo3a A T 2: 22,396,315 S632C probably damaging Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Nbeal1 T A 1: 60,267,941 Y374* probably null Het
Notch3 T C 17: 32,153,852 S582G probably benign Het
Nphs1 A T 7: 30,474,373 Q985L probably damaging Het
Oas1c T A 5: 120,802,984 H248L probably benign Het
Olfr154 T C 2: 85,663,997 I146V probably benign Het
Olfr193 A T 16: 59,109,794 M272K probably benign Het
Olfr368 A T 2: 37,331,884 N46Y probably damaging Het
Olfr955 A G 9: 39,470,037 S230P possibly damaging Het
Pamr1 A T 2: 102,642,272 I639F possibly damaging Het
Panx1 G T 9: 15,007,684 T293K possibly damaging Het
Papss1 G T 3: 131,599,871 V226F probably benign Het
Pax1 G T 2: 147,367,889 G301V possibly damaging Het
Pdlim5 C A 3: 142,244,981 R557L possibly damaging Het
Pdyn C A 2: 129,689,809 M20I probably benign Het
Pelp1 G A 11: 70,393,715 probably null Het
Pkd2 T C 5: 104,478,924 V324A probably damaging Het
Pkdrej A G 15: 85,819,167 I856T probably benign Het
Polr1a T C 6: 71,936,552 probably null Het
Pot1a A T 6: 25,753,324 D404E probably benign Het
Ppp2r2a A T 14: 67,016,429 I430N possibly damaging Het
Prob1 C T 18: 35,654,226 R325Q possibly damaging Het
Prrc2a T C 17: 35,157,908 D742G probably damaging Het
Psmc1 C T 12: 100,114,843 P54S probably benign Het
Rab22a A G 2: 173,688,211 T61A probably damaging Het
Rims1 T A 1: 22,288,530 K184N probably damaging Het
Ryr2 T C 13: 11,668,962 E3072G probably damaging Het
Serpina1b T C 12: 103,732,161 K143R probably benign Het
Slc22a15 T G 3: 101,880,189 probably null Het
Slc25a14 G A X: 48,651,963 V210I probably benign Het
Slc25a48 A C 13: 56,448,998 T31P probably damaging Het
Slc9a3 C T 13: 74,166,056 probably null Het
Slx4 T C 16: 3,987,166 *105W probably null Het
Smc6 A G 12: 11,299,398 N794S probably benign Het
Spata18 G A 5: 73,676,964 R387Q probably damaging Het
Sphkap C A 1: 83,267,441 E1486* probably null Het
Srsf6 C T 2: 162,934,483 probably benign Het
St8sia1 C T 6: 142,963,672 A33T probably damaging Het
Tet2 T C 3: 133,488,638 T12A possibly damaging Het
Tmem144 G T 3: 79,825,304 S222R probably damaging Het
Tnrc6c A G 11: 117,756,023 D1450G possibly damaging Het
Top1 A T 2: 160,670,122 K27N unknown Het
Tox2 A G 2: 163,225,556 H30R probably benign Het
Tra2b T C 16: 22,247,243 probably benign Het
Trio A T 15: 27,833,056 V1165E probably damaging Het
Troap T A 15: 99,077,388 S145R probably damaging Het
Ttc34 G A 4: 154,865,682 A1031T possibly damaging Het
Ttc6 C T 12: 57,616,323 P302S probably benign Het
Ubiad1 A G 4: 148,444,011 L147P probably damaging Het
Ugt2b35 G T 5: 87,001,282 V131F probably damaging Het
Vmn1r167 G A 7: 23,505,027 T188I probably benign Het
Vmn1r46 G T 6: 89,976,734 M188I probably benign Het
Vmn2r115 T A 17: 23,359,414 N620K probably damaging Het
Vmn2r66 A G 7: 84,995,136 S689P probably damaging Het
Wipf2 C T 11: 98,892,410 R221* probably null Het
Zbtb16 T C 9: 48,659,778 S563G probably benign Het
Zfp319 T C 8: 95,328,571 T335A probably damaging Het
Zfp418 A G 7: 7,182,402 R455G possibly damaging Het
Other mutations in Rnf213
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Rnf213 APN 11 119449343 missense probably benign 0.00
IGL00961:Rnf213 APN 11 119440843 missense possibly damaging 0.55
IGL01324:Rnf213 APN 11 119447237 missense probably damaging 1.00
IGL01351:Rnf213 APN 11 119483118 missense probably benign 0.25
IGL01403:Rnf213 APN 11 119443300 missense probably damaging 1.00
IGL01704:Rnf213 APN 11 119449876 critical splice donor site probably null
IGL01765:Rnf213 APN 11 119436352 missense probably benign 0.00
IGL01803:Rnf213 APN 11 119441307 missense probably damaging 1.00
IGL01804:Rnf213 APN 11 119442266 missense probably damaging 1.00
IGL01900:Rnf213 APN 11 119443015 missense probably benign 0.05
IGL01944:Rnf213 APN 11 119416457 missense probably benign 0.01
IGL01982:Rnf213 APN 11 119443268 missense probably damaging 1.00
IGL02008:Rnf213 APN 11 119418309 splice site probably benign
IGL02084:Rnf213 APN 11 119445673 missense probably benign 0.04
IGL02253:Rnf213 APN 11 119440650 missense probably benign 0.03
IGL02254:Rnf213 APN 11 119480907 missense possibly damaging 0.89
IGL02296:Rnf213 APN 11 119463336 missense probably benign 0.01
IGL02531:Rnf213 APN 11 119436802 missense probably benign
IGL02588:Rnf213 APN 11 119416536 missense probably benign 0.30
IGL02615:Rnf213 APN 11 119440789 missense probably damaging 0.96
IGL02805:Rnf213 APN 11 119435066 missense probably damaging 0.99
IGL02887:Rnf213 APN 11 119427510 missense probably damaging 1.00
IGL03001:Rnf213 APN 11 119479941 missense probably damaging 1.00
IGL03035:Rnf213 APN 11 119445626 splice site probably benign
IGL03057:Rnf213 APN 11 119441087 missense probably damaging 1.00
IGL03148:Rnf213 APN 11 119465007 missense probably damaging 1.00
IGL03308:Rnf213 APN 11 119474172 missense probably benign 0.03
IGL03339:Rnf213 APN 11 119443004 missense probably damaging 1.00
IGL03369:Rnf213 APN 11 119421468 missense probably benign 0.34
attrition UTSW 11 119430321 missense possibly damaging 0.77
defame UTSW 11 119430281 nonsense probably null
Derogate UTSW 11 119470210 missense probably damaging 1.00
dinky UTSW 11 119416458 missense probably damaging 0.99
Impugn UTSW 11 119436823 nonsense probably null
B6584:Rnf213 UTSW 11 119426069 missense probably damaging 0.97
PIT4585001:Rnf213 UTSW 11 119458392 missense
R0008:Rnf213 UTSW 11 119465052 missense possibly damaging 0.82
R0015:Rnf213 UTSW 11 119441606 missense possibly damaging 0.95
R0041:Rnf213 UTSW 11 119402575 missense probably benign 0.41
R0114:Rnf213 UTSW 11 119414587 missense probably damaging 1.00
R0131:Rnf213 UTSW 11 119430361 missense probably benign 0.10
R0131:Rnf213 UTSW 11 119430361 missense probably benign 0.10
R0132:Rnf213 UTSW 11 119430361 missense probably benign 0.10
R0138:Rnf213 UTSW 11 119416496 missense probably benign 0.05
R0144:Rnf213 UTSW 11 119479600 nonsense probably null
R0184:Rnf213 UTSW 11 119414521 missense probably damaging 0.99
R0321:Rnf213 UTSW 11 119438105 nonsense probably null
R0365:Rnf213 UTSW 11 119426111 missense possibly damaging 0.74
R0415:Rnf213 UTSW 11 119414469 missense probably damaging 1.00
R0421:Rnf213 UTSW 11 119447257 missense probably damaging 1.00
R0494:Rnf213 UTSW 11 119426012 missense possibly damaging 0.65
R0494:Rnf213 UTSW 11 119443120 missense probably damaging 1.00
R0549:Rnf213 UTSW 11 119465082 missense probably damaging 1.00
R0577:Rnf213 UTSW 11 119443280 missense probably damaging 1.00
R0605:Rnf213 UTSW 11 119431717 missense probably benign 0.03
R0638:Rnf213 UTSW 11 119470210 missense probably damaging 1.00
R0675:Rnf213 UTSW 11 119441834 missense probably benign 0.28
R0715:Rnf213 UTSW 11 119441150 missense probably damaging 0.97
R0732:Rnf213 UTSW 11 119441068 missense probably damaging 0.99
R0748:Rnf213 UTSW 11 119473480 missense probably damaging 1.00
R0765:Rnf213 UTSW 11 119423095 critical splice donor site probably null
R0890:Rnf213 UTSW 11 119430486 missense possibly damaging 0.94
R0927:Rnf213 UTSW 11 119414570 missense probably benign 0.00
R0940:Rnf213 UTSW 11 119416563 missense probably benign 0.10
R0959:Rnf213 UTSW 11 119452581 missense probably damaging 0.99
R1077:Rnf213 UTSW 11 119485998 splice site probably benign
R1104:Rnf213 UTSW 11 119477229 missense probably benign 0.29
R1141:Rnf213 UTSW 11 119435983 missense probably benign 0.02
R1219:Rnf213 UTSW 11 119436177 missense probably damaging 1.00
R1435:Rnf213 UTSW 11 119436005 missense probably damaging 1.00
R1444:Rnf213 UTSW 11 119442400 missense probably damaging 1.00
R1474:Rnf213 UTSW 11 119437750 missense probably damaging 1.00
R1488:Rnf213 UTSW 11 119480889 missense probably benign 0.05
R1523:Rnf213 UTSW 11 119441888 missense probably damaging 1.00
R1548:Rnf213 UTSW 11 119442707 missense probably damaging 1.00
R1554:Rnf213 UTSW 11 119441839 missense probably benign 0.06
R1563:Rnf213 UTSW 11 119414526 missense probably benign 0.13
R1572:Rnf213 UTSW 11 119436611 missense probably damaging 1.00
R1585:Rnf213 UTSW 11 119463345 missense probably damaging 1.00
R1635:Rnf213 UTSW 11 119442579 missense probably damaging 0.97
R1663:Rnf213 UTSW 11 119437672 missense probably benign 0.01
R1789:Rnf213 UTSW 11 119440221 missense probably damaging 0.97
R1844:Rnf213 UTSW 11 119441183 missense probably damaging 1.00
R1871:Rnf213 UTSW 11 119450129 missense probably benign 0.08
R1893:Rnf213 UTSW 11 119416448 missense probably damaging 1.00
R1967:Rnf213 UTSW 11 119480895 missense probably damaging 1.00
R1987:Rnf213 UTSW 11 119441107 missense probably damaging 1.00
R2000:Rnf213 UTSW 11 119436022 missense probably damaging 1.00
R2020:Rnf213 UTSW 11 119461918 missense probably damaging 0.99
R2100:Rnf213 UTSW 11 119467302 nonsense probably null
R2109:Rnf213 UTSW 11 119442663 nonsense probably null
R2115:Rnf213 UTSW 11 119428013 missense probably benign 0.00
R2126:Rnf213 UTSW 11 119450201 missense probably damaging 0.99
R2144:Rnf213 UTSW 11 119443690 missense probably damaging 0.99
R2145:Rnf213 UTSW 11 119415193 missense probably benign 0.03
R2168:Rnf213 UTSW 11 119415070 missense probably damaging 0.97
R2189:Rnf213 UTSW 11 119430361 missense probably benign 0.10
R2199:Rnf213 UTSW 11 119460009 missense probably benign 0.01
R2220:Rnf213 UTSW 11 119436428 missense possibly damaging 0.94
R2336:Rnf213 UTSW 11 119414604 missense probably benign 0.02
R2400:Rnf213 UTSW 11 119443195 missense probably damaging 1.00
R2679:Rnf213 UTSW 11 119459938 splice site probably null
R2698:Rnf213 UTSW 11 119410144 missense probably benign 0.26
R3151:Rnf213 UTSW 11 119468892 missense probably benign 0.03
R3607:Rnf213 UTSW 11 119441976 nonsense probably null
R3808:Rnf213 UTSW 11 119479558 missense probably damaging 1.00
R3854:Rnf213 UTSW 11 119480939 splice site probably benign
R3856:Rnf213 UTSW 11 119480939 splice site probably benign
R3973:Rnf213 UTSW 11 119469053 missense probably benign 0.27
R4014:Rnf213 UTSW 11 119445729 nonsense probably null
R4049:Rnf213 UTSW 11 119482448 missense possibly damaging 0.67
R4130:Rnf213 UTSW 11 119483006 missense probably damaging 1.00
R4153:Rnf213 UTSW 11 119409482 missense probably benign 0.27
R4167:Rnf213 UTSW 11 119441243 missense probably damaging 0.99
R4224:Rnf213 UTSW 11 119436823 nonsense probably null
R4332:Rnf213 UTSW 11 119436676 missense probably damaging 1.00
R4415:Rnf213 UTSW 11 119483964 missense probably damaging 0.99
R4547:Rnf213 UTSW 11 119479670 critical splice donor site probably null
R4609:Rnf213 UTSW 11 119437695 missense possibly damaging 0.86
R4684:Rnf213 UTSW 11 119441125 missense probably damaging 1.00
R4704:Rnf213 UTSW 11 119440349 missense probably damaging 1.00
R4719:Rnf213 UTSW 11 119420067 missense probably benign 0.38
R4751:Rnf213 UTSW 11 119445745 missense probably benign 0.12
R4828:Rnf213 UTSW 11 119416629 missense possibly damaging 0.61
R4837:Rnf213 UTSW 11 119442763 missense probably benign 0.00
R4894:Rnf213 UTSW 11 119481240 missense probably damaging 1.00
R4973:Rnf213 UTSW 11 119428157 missense possibly damaging 0.84
R5026:Rnf213 UTSW 11 119436764 missense probably damaging 1.00
R5034:Rnf213 UTSW 11 119410807 missense probably damaging 0.99
R5284:Rnf213 UTSW 11 119458866 missense possibly damaging 0.89
R5295:Rnf213 UTSW 11 119440816 missense probably benign 0.00
R5406:Rnf213 UTSW 11 119440808 missense probably damaging 1.00
R5441:Rnf213 UTSW 11 119409020 missense probably damaging 0.99
R5449:Rnf213 UTSW 11 119415076 missense probably benign 0.44
R5520:Rnf213 UTSW 11 119433499 missense probably damaging 1.00
R5636:Rnf213 UTSW 11 119436629 missense probably benign 0.04
R5636:Rnf213 UTSW 11 119436905 missense probably damaging 1.00
R5669:Rnf213 UTSW 11 119458785 missense possibly damaging 0.92
R5670:Rnf213 UTSW 11 119434686 critical splice acceptor site probably null
R5697:Rnf213 UTSW 11 119483894 missense possibly damaging 0.54
R5726:Rnf213 UTSW 11 119416458 missense probably damaging 0.99
R5808:Rnf213 UTSW 11 119436295 missense probably benign
R5861:Rnf213 UTSW 11 119473377 missense probably damaging 1.00
R5903:Rnf213 UTSW 11 119421369 missense probably damaging 0.98
R5949:Rnf213 UTSW 11 119443079 missense probably damaging 1.00
R6022:Rnf213 UTSW 11 119486010 missense probably benign 0.00
R6043:Rnf213 UTSW 11 119442101 missense probably damaging 0.97
R6089:Rnf213 UTSW 11 119416559 missense probably benign 0.14
R6123:Rnf213 UTSW 11 119411513 missense probably damaging 0.96
R6134:Rnf213 UTSW 11 119411470 missense probably damaging 0.99
R6135:Rnf213 UTSW 11 119442028 missense probably benign 0.02
R6146:Rnf213 UTSW 11 119435999 missense probably benign 0.41
R6163:Rnf213 UTSW 11 119458428 missense possibly damaging 0.86
R6272:Rnf213 UTSW 11 119414548 missense probably damaging 1.00
R6333:Rnf213 UTSW 11 119463366 missense probably damaging 1.00
R6370:Rnf213 UTSW 11 119477078 missense probably damaging 0.99
R6456:Rnf213 UTSW 11 119459966 missense probably benign 0.03
R6468:Rnf213 UTSW 11 119452687 missense possibly damaging 0.94
R6579:Rnf213 UTSW 11 119436280 missense probably damaging 0.96
R6648:Rnf213 UTSW 11 119479920 missense possibly damaging 0.81
R6727:Rnf213 UTSW 11 119430321 missense possibly damaging 0.77
R6739:Rnf213 UTSW 11 119442271 missense probably damaging 1.00
R6768:Rnf213 UTSW 11 119442236 missense probably damaging 0.99
R6817:Rnf213 UTSW 11 119462285 critical splice donor site probably null
R6820:Rnf213 UTSW 11 119448838 missense probably damaging 1.00
R6841:Rnf213 UTSW 11 119449866 missense probably benign 0.26
R6934:Rnf213 UTSW 11 119420067 missense probably benign 0.38
R7026:Rnf213 UTSW 11 119479655 missense possibly damaging 0.58
R7094:Rnf213 UTSW 11 119437604 splice site probably null
R7170:Rnf213 UTSW 11 119452575 missense
R7185:Rnf213 UTSW 11 119424198 missense
R7239:Rnf213 UTSW 11 119458788 missense
R7258:Rnf213 UTSW 11 119452575 missense
R7259:Rnf213 UTSW 11 119452575 missense
R7260:Rnf213 UTSW 11 119452575 missense
R7273:Rnf213 UTSW 11 119431756 splice site probably null
R7282:Rnf213 UTSW 11 119437992 missense
R7311:Rnf213 UTSW 11 119416547 missense
R7352:Rnf213 UTSW 11 119443579 missense
R7369:Rnf213 UTSW 11 119430468 missense
R7410:Rnf213 UTSW 11 119435051 missense
R7448:Rnf213 UTSW 11 119481291 missense
R7561:Rnf213 UTSW 11 119441719 missense
R7573:Rnf213 UTSW 11 119458484 missense
R7615:Rnf213 UTSW 11 119467297 missense
R7680:Rnf213 UTSW 11 119479556 missense
R7739:Rnf213 UTSW 11 119410861 missense
R7789:Rnf213 UTSW 11 119470219 splice site probably null
R7806:Rnf213 UTSW 11 119411545 missense
R8031:Rnf213 UTSW 11 119430281 nonsense probably null
R8042:Rnf213 UTSW 11 119441654 missense
R8053:Rnf213 UTSW 11 119402647 missense
R8284:Rnf213 UTSW 11 119428083 missense
R8301:Rnf213 UTSW 11 119434742 missense
R8325:Rnf213 UTSW 11 119430445 missense
R8332:Rnf213 UTSW 11 119483698 missense
R8443:Rnf213 UTSW 11 119449323 missense
R8518:Rnf213 UTSW 11 119462217 missense
R8531:Rnf213 UTSW 11 119474205 missense probably benign 0.02
R8670:Rnf213 UTSW 11 119458737 missense
R8675:Rnf213 UTSW 11 119456158 missense
R8690:Rnf213 UTSW 11 119418129 missense
R8690:Rnf213 UTSW 11 119441212 missense
R8714:Rnf213 UTSW 11 119468894 missense
R8802:Rnf213 UTSW 11 119462102 missense
S24628:Rnf213 UTSW 11 119414469 missense probably damaging 1.00
X0021:Rnf213 UTSW 11 119441824 missense probably benign 0.14
X0062:Rnf213 UTSW 11 119473513 missense probably benign 0.05
X0064:Rnf213 UTSW 11 119440463 missense probably damaging 1.00
Z1088:Rnf213 UTSW 11 119477254 missense possibly damaging 0.69
Z1176:Rnf213 UTSW 11 119441410 missense
Z1176:Rnf213 UTSW 11 119482998 missense
Predicted Primers PCR Primer
(F):5'- AAGTGCCAGGCTCTTGCTATG -3'
(R):5'- TATTCACAGCAAGCGGGGAG -3'

Sequencing Primer
(F):5'- CCAGGCTCTTGCTATGGGTTG -3'
(R):5'- GACACCGTCTGAGTAAAACATG -3'
Posted On2014-07-14