Incidental Mutation 'R1937:Dhx29'
ID213585
Institutional Source Beutler Lab
Gene Symbol Dhx29
Ensembl Gene ENSMUSG00000042426
Gene NameDEAH (Asp-Glu-Ala-His) box polypeptide 29
SynonymsE130202M19Rik
MMRRC Submission 039955-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1937 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location112927454-112969432 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 112965330 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 1311 (G1311D)
Ref Sequence ENSEMBL: ENSMUSP00000035244 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038574]
Predicted Effect probably benign
Transcript: ENSMUST00000038574
AA Change: G1311D

PolyPhen 2 Score 0.065 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000035244
Gene: ENSMUSG00000042426
AA Change: G1311D

DomainStartEndE-ValueType
low complexity region 10 36 N/A INTRINSIC
low complexity region 41 54 N/A INTRINSIC
low complexity region 209 225 N/A INTRINSIC
low complexity region 240 255 N/A INTRINSIC
coiled coil region 279 308 N/A INTRINSIC
low complexity region 343 358 N/A INTRINSIC
Blast:DEXDc 411 450 2e-14 BLAST
DEXDc 569 763 1.09e-27 SMART
low complexity region 846 856 N/A INTRINSIC
HELICc 880 985 6.1e-17 SMART
HA2 1047 1138 8.9e-26 SMART
Pfam:OB_NTP_bind 1178 1298 3.8e-19 PFAM
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.7%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DEAH (Asp-Glu-Ala-His) subfamily of proteins, part of the DEAD (Asp-Glu-Ala-Asp) box family of RNA helicases. The encoded protein functions in translation initiation, and is specifically required for ribosomal scanning across stable mRNA secondary structures during initiation codon selection. This protein may also play a role in sensing virally derived cytosolic nucleic acids. Knockdown of this gene results in reduced protein translation and impaired proliferation of cancer cells. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E7. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006E09Rik A T 11: 101,987,163 H17L probably damaging Het
5730480H06Rik C A 5: 48,374,435 T35K probably benign Het
Abhd14a A G 9: 106,440,247 probably benign Het
Abhd8 A G 8: 71,461,862 F41L possibly damaging Het
Ace2 A T X: 164,156,528 M123L possibly damaging Het
Actr5 T C 2: 158,636,029 Y440H possibly damaging Het
Akr1c6 T A 13: 4,446,384 N81K probably benign Het
Aqp11 T A 7: 97,737,518 N157I possibly damaging Het
Arhgap10 T C 8: 77,344,653 E568G probably damaging Het
Asb7 T A 7: 66,679,253 Q13L probably benign Het
Atf7ip C A 6: 136,560,780 A345E probably benign Het
Atp8a2 T C 14: 59,860,270 K770E probably benign Het
Bpifb4 A T 2: 153,944,076 I259F probably damaging Het
Cand1 A T 10: 119,203,020 D1218E probably damaging Het
Capg A G 6: 72,558,253 probably null Het
Cep290 C T 10: 100,497,953 T289M possibly damaging Het
Cfap69 T C 5: 5,593,818 Y548C probably damaging Het
Clock A G 5: 76,229,493 L652P probably damaging Het
Col3a1 C T 1: 45,334,293 probably benign Het
Coro7 T C 16: 4,628,732 E843G probably benign Het
Crebrf T C 17: 26,742,468 S188P probably damaging Het
Cul1 T C 6: 47,508,355 F307L probably benign Het
Cyb561d2 G A 9: 107,540,316 R79W probably damaging Het
Cyp3a59 T C 5: 146,094,377 S117P possibly damaging Het
Ddias A G 7: 92,858,622 I695T probably benign Het
Diexf A T 1: 193,122,093 D200E probably damaging Het
Dync2h1 A G 9: 7,139,159 probably null Het
Ece2 T A 16: 20,617,866 V146E probably damaging Het
Eml2 A G 7: 19,203,964 K586E possibly damaging Het
Eps8l3 A G 3: 107,884,392 E316G probably benign Het
Fam135b A T 15: 71,622,014 L22H probably damaging Het
Fam166b T A 4: 43,427,586 K220N probably damaging Het
Focad T A 4: 88,401,081 M1K probably null Het
Fryl A G 5: 73,133,367 S65P probably damaging Het
Gm14190 C T 11: 99,690,730 C4Y unknown Het
Gm8909 T A 17: 36,168,007 T117S probably damaging Het
Ift74 T A 4: 94,662,646 M345K probably benign Het
Ispd G A 12: 36,390,368 V92I probably benign Het
Jag1 C G 2: 137,083,473 V1070L possibly damaging Het
Kcng1 T C 2: 168,263,021 T302A probably benign Het
Kif20b T C 19: 34,952,878 V1221A possibly damaging Het
Kif23 A T 9: 61,946,610 probably null Het
Lpxn T G 19: 12,824,910 S200A probably benign Het
Meiob A G 17: 24,818,331 H61R probably benign Het
Mfhas1 C T 8: 35,589,645 L425F probably damaging Het
Myo3a A T 2: 22,396,315 S632C probably damaging Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Nbeal1 T A 1: 60,267,941 Y374* probably null Het
Notch3 T C 17: 32,153,852 S582G probably benign Het
Nphs1 A T 7: 30,474,373 Q985L probably damaging Het
Oas1c T A 5: 120,802,984 H248L probably benign Het
Olfr154 T C 2: 85,663,997 I146V probably benign Het
Olfr193 A T 16: 59,109,794 M272K probably benign Het
Olfr368 A T 2: 37,331,884 N46Y probably damaging Het
Olfr955 A G 9: 39,470,037 S230P possibly damaging Het
Pamr1 A T 2: 102,642,272 I639F possibly damaging Het
Panx1 G T 9: 15,007,684 T293K possibly damaging Het
Papss1 G T 3: 131,599,871 V226F probably benign Het
Pax1 G T 2: 147,367,889 G301V possibly damaging Het
Pdlim5 C A 3: 142,244,981 R557L possibly damaging Het
Pdyn C A 2: 129,689,809 M20I probably benign Het
Pelp1 G A 11: 70,393,715 probably null Het
Pkd2 T C 5: 104,478,924 V324A probably damaging Het
Pkdrej A G 15: 85,819,167 I856T probably benign Het
Polr1a T C 6: 71,936,552 probably null Het
Pot1a A T 6: 25,753,324 D404E probably benign Het
Ppp2r2a A T 14: 67,016,429 I430N possibly damaging Het
Prob1 C T 18: 35,654,226 R325Q possibly damaging Het
Prrc2a T C 17: 35,157,908 D742G probably damaging Het
Psmc1 C T 12: 100,114,843 P54S probably benign Het
Rab22a A G 2: 173,688,211 T61A probably damaging Het
Rims1 T A 1: 22,288,530 K184N probably damaging Het
Rnf213 G A 11: 119,431,685 R1376H probably damaging Het
Ryr2 T C 13: 11,668,962 E3072G probably damaging Het
Serpina1b T C 12: 103,732,161 K143R probably benign Het
Slc22a15 T G 3: 101,880,189 probably null Het
Slc25a14 G A X: 48,651,963 V210I probably benign Het
Slc25a48 A C 13: 56,448,998 T31P probably damaging Het
Slc9a3 C T 13: 74,166,056 probably null Het
Slx4 T C 16: 3,987,166 *105W probably null Het
Smc6 A G 12: 11,299,398 N794S probably benign Het
Spata18 G A 5: 73,676,964 R387Q probably damaging Het
Sphkap C A 1: 83,267,441 E1486* probably null Het
Srsf6 C T 2: 162,934,483 probably benign Het
St8sia1 C T 6: 142,963,672 A33T probably damaging Het
Tet2 T C 3: 133,488,638 T12A possibly damaging Het
Tmem144 G T 3: 79,825,304 S222R probably damaging Het
Tnrc6c A G 11: 117,756,023 D1450G possibly damaging Het
Top1 A T 2: 160,670,122 K27N unknown Het
Tox2 A G 2: 163,225,556 H30R probably benign Het
Tra2b T C 16: 22,247,243 probably benign Het
Trio A T 15: 27,833,056 V1165E probably damaging Het
Troap T A 15: 99,077,388 S145R probably damaging Het
Ttc34 G A 4: 154,865,682 A1031T possibly damaging Het
Ttc6 C T 12: 57,616,323 P302S probably benign Het
Ubiad1 A G 4: 148,444,011 L147P probably damaging Het
Ugt2b35 G T 5: 87,001,282 V131F probably damaging Het
Vmn1r167 G A 7: 23,505,027 T188I probably benign Het
Vmn1r46 G T 6: 89,976,734 M188I probably benign Het
Vmn2r115 T A 17: 23,359,414 N620K probably damaging Het
Vmn2r66 A G 7: 84,995,136 S689P probably damaging Het
Wipf2 C T 11: 98,892,410 R221* probably null Het
Zbtb16 T C 9: 48,659,778 S563G probably benign Het
Zfp319 T C 8: 95,328,571 T335A probably damaging Het
Zfp418 A G 7: 7,182,402 R455G possibly damaging Het
Other mutations in Dhx29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Dhx29 APN 13 112964603 missense probably benign 0.15
IGL00434:Dhx29 APN 13 112955225 missense probably benign 0.00
IGL00659:Dhx29 APN 13 112966635 splice site probably benign
IGL01618:Dhx29 APN 13 112965222 missense probably damaging 1.00
IGL01777:Dhx29 APN 13 112930872 missense probably benign 0.42
IGL02010:Dhx29 APN 13 112966634 critical splice donor site probably null
IGL02125:Dhx29 APN 13 112955300 splice site probably benign
IGL02324:Dhx29 APN 13 112927808 missense probably damaging 1.00
IGL02801:Dhx29 APN 13 112964646 missense probably damaging 1.00
R0001:Dhx29 UTSW 13 112964556 missense probably damaging 0.99
R0362:Dhx29 UTSW 13 112962859 missense probably benign
R0468:Dhx29 UTSW 13 112963277 missense probably benign
R0569:Dhx29 UTSW 13 112948214 missense probably benign 0.01
R0714:Dhx29 UTSW 13 112927965 missense possibly damaging 0.55
R1460:Dhx29 UTSW 13 112965210 splice site probably benign
R1579:Dhx29 UTSW 13 112935598 critical splice donor site probably null
R1657:Dhx29 UTSW 13 112952843 missense probably damaging 1.00
R1735:Dhx29 UTSW 13 112945086 missense probably benign 0.00
R1768:Dhx29 UTSW 13 112948240 missense probably damaging 1.00
R1851:Dhx29 UTSW 13 112948281 missense probably damaging 1.00
R2180:Dhx29 UTSW 13 112962872 critical splice donor site probably null
R2219:Dhx29 UTSW 13 112952804 missense probably damaging 1.00
R2442:Dhx29 UTSW 13 112946974 missense possibly damaging 0.94
R2679:Dhx29 UTSW 13 112947376 critical splice donor site probably null
R2908:Dhx29 UTSW 13 112927851 missense possibly damaging 0.78
R2912:Dhx29 UTSW 13 112935575 missense probably damaging 1.00
R3414:Dhx29 UTSW 13 112947273 missense probably damaging 0.99
R3931:Dhx29 UTSW 13 112958965 missense probably damaging 1.00
R3957:Dhx29 UTSW 13 112930921 missense probably benign
R4065:Dhx29 UTSW 13 112964742 critical splice donor site probably null
R4207:Dhx29 UTSW 13 112927949 missense probably benign 0.01
R4422:Dhx29 UTSW 13 112947247 missense probably damaging 1.00
R4717:Dhx29 UTSW 13 112946935 missense unknown
R4718:Dhx29 UTSW 13 112946935 missense unknown
R5125:Dhx29 UTSW 13 112932600 missense possibly damaging 0.81
R5178:Dhx29 UTSW 13 112932600 missense possibly damaging 0.81
R5263:Dhx29 UTSW 13 112948221 missense probably damaging 1.00
R5458:Dhx29 UTSW 13 112966621 missense probably benign 0.00
R5469:Dhx29 UTSW 13 112944539 missense possibly damaging 0.94
R5541:Dhx29 UTSW 13 112940374 missense possibly damaging 0.47
R5573:Dhx29 UTSW 13 112933215 missense probably benign 0.07
R5664:Dhx29 UTSW 13 112946879 missense probably damaging 1.00
R5682:Dhx29 UTSW 13 112930849 missense probably damaging 1.00
R5769:Dhx29 UTSW 13 112953717 missense probably damaging 0.99
R5917:Dhx29 UTSW 13 112962843 missense probably damaging 1.00
R5928:Dhx29 UTSW 13 112964468 missense probably benign 0.00
R6115:Dhx29 UTSW 13 112952801 critical splice acceptor site probably null
R6144:Dhx29 UTSW 13 112964571 missense probably damaging 1.00
R6195:Dhx29 UTSW 13 112964537 missense probably benign 0.08
R6233:Dhx29 UTSW 13 112964537 missense probably benign 0.08
R6430:Dhx29 UTSW 13 112944619 missense possibly damaging 0.77
R6480:Dhx29 UTSW 13 112953788 nonsense probably null
R6527:Dhx29 UTSW 13 112932542 missense probably damaging 1.00
R6856:Dhx29 UTSW 13 112952861 missense probably benign 0.43
R7391:Dhx29 UTSW 13 112962859 missense probably benign
R7555:Dhx29 UTSW 13 112927642 start gained probably benign
R7602:Dhx29 UTSW 13 112944559 missense possibly damaging 0.95
R7974:Dhx29 UTSW 13 112940752 intron probably null
Z1177:Dhx29 UTSW 13 112955517 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- GCAATGTGGTTGTGTAAACATACG -3'
(R):5'- TACGTTCTGTGACAGCAACATG -3'

Sequencing Primer
(F):5'- TCTACCTGAGAGAGACGA -3'
(R):5'- CTGTGACAGCAACATGATCTTC -3'
Posted On2014-07-14