Incidental Mutation 'R1938:Plcb1'
ID 213636
Institutional Source Beutler Lab
Gene Symbol Plcb1
Ensembl Gene ENSMUSG00000051177
Gene Name phospholipase C, beta 1
Synonyms 3110043I21Rik
MMRRC Submission 039956-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.204) question?
Stock # R1938 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 134628084-135317178 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 135228222 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 1073 (D1073V)
Ref Sequence ENSEMBL: ENSMUSP00000118756 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070724] [ENSMUST00000110116] [ENSMUST00000131552]
AlphaFold Q9Z1B3
Predicted Effect probably damaging
Transcript: ENSMUST00000070724
AA Change: D1073V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064844
Gene: ENSMUSG00000051177
AA Change: D1073V

DomainStartEndE-ValueType
Pfam:EF-hand_like 224 315 2.2e-26 PFAM
PLCXc 316 467 2.85e-74 SMART
low complexity region 491 501 N/A INTRINSIC
PLCYc 540 656 2e-69 SMART
C2 677 776 1.55e-12 SMART
low complexity region 871 885 N/A INTRINSIC
Pfam:DUF1154 903 946 1.3e-7 PFAM
low complexity region 967 984 N/A INTRINSIC
Pfam:PLC-beta_C 997 1155 1.9e-64 PFAM
low complexity region 1157 1168 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110116
AA Change: D1073V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105743
Gene: ENSMUSG00000051177
AA Change: D1073V

DomainStartEndE-ValueType
Pfam:EF-hand_like 224 315 4.1e-26 PFAM
PLCXc 316 467 2.85e-74 SMART
low complexity region 491 501 N/A INTRINSIC
PLCYc 540 656 2e-69 SMART
C2 677 776 1.55e-12 SMART
low complexity region 871 885 N/A INTRINSIC
Pfam:DUF1154 903 946 1.1e-9 PFAM
low complexity region 967 984 N/A INTRINSIC
Pfam:PLC-beta_C 1003 1176 2.9e-61 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000131552
AA Change: D1073V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118756
Gene: ENSMUSG00000051177
AA Change: D1073V

DomainStartEndE-ValueType
Pfam:EF-hand_like 224 315 3.9e-26 PFAM
PLCXc 316 467 2.85e-74 SMART
low complexity region 491 501 N/A INTRINSIC
PLCYc 540 656 2e-69 SMART
C2 677 776 1.55e-12 SMART
low complexity region 871 885 N/A INTRINSIC
Pfam:DUF1154 903 946 1e-9 PFAM
low complexity region 967 984 N/A INTRINSIC
Pfam:PLC-beta_C 1003 1148 8e-51 PFAM
low complexity region 1157 1168 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153402
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the formation of inositol 1,4,5-trisphosphate and diacylglycerol from phosphatidylinositol 4,5-bisphosphate. This reaction uses calcium as a cofactor and plays an important role in the intracellular transduction of many extracellular signals. This gene is activated by two G-protein alpha subunits, alpha-q and alpha-11. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit spontaneous seizures and high mortality around 3 weeks of age. Mutant males show exhibit sperm with a reduced acrosome reaction rate and fertilizing capacity in vitro and decreased fertility in vivo. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 133 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 T C 7: 45,824,795 (GRCm39) K134R possibly damaging Het
Adamts17 T C 7: 66,774,820 (GRCm39) S980P probably damaging Het
Adap2 T A 11: 80,061,508 (GRCm39) I221K probably damaging Het
Adgrv1 C T 13: 81,539,876 (GRCm39) R5681Q probably damaging Het
Adipor1 T A 1: 134,350,841 (GRCm39) L30Q probably benign Het
Agpat5 A G 8: 18,928,181 (GRCm39) T249A probably benign Het
Agxt2 G T 15: 10,392,021 (GRCm39) G329V probably damaging Het
Ankrd28 A G 14: 31,427,233 (GRCm39) V801A possibly damaging Het
Ap1g2 A G 14: 55,337,229 (GRCm39) V702A possibly damaging Het
Arid3a A G 10: 79,786,540 (GRCm39) Q429R probably damaging Het
Arsb T A 13: 93,998,658 (GRCm39) L322Q probably damaging Het
Ash1l A G 3: 88,891,729 (GRCm39) T1203A probably damaging Het
Atad2 T A 15: 57,960,101 (GRCm39) N1308Y possibly damaging Het
Atp10b A T 11: 43,121,245 (GRCm39) R969S probably benign Het
Bmp10 T C 6: 87,410,702 (GRCm39) I165T possibly damaging Het
Ccdc121rt2 C A 5: 112,597,667 (GRCm39) C71* probably null Het
Ccne1 A G 7: 37,805,702 (GRCm39) probably null Het
Cenpe A G 3: 134,953,240 (GRCm39) N1565D probably damaging Het
Chd1 A T 17: 15,982,748 (GRCm39) E1404D probably benign Het
Chd7 G A 4: 8,847,200 (GRCm39) E1648K probably damaging Het
Chodl T C 16: 78,738,314 (GRCm39) I94T possibly damaging Het
Chsy3 T C 18: 59,542,584 (GRCm39) F574S probably damaging Het
Clpb A T 7: 101,412,863 (GRCm39) I317F probably damaging Het
Cnga3 T A 1: 37,300,954 (GRCm39) V558D possibly damaging Het
Col9a1 C T 1: 24,261,554 (GRCm39) P573S probably damaging Het
Crat A T 2: 30,303,073 (GRCm39) D71E probably benign Het
Cspg4 A G 9: 56,794,385 (GRCm39) T707A probably benign Het
Ctsr T A 13: 61,310,259 (GRCm39) R132S probably benign Het
Ctu2 T C 8: 123,206,024 (GRCm39) L255P probably damaging Het
Cyp2c69 T C 19: 39,837,810 (GRCm39) Y424C probably damaging Het
Ddx27 A T 2: 166,876,029 (GRCm39) K726N probably damaging Het
Dennd4a A G 9: 64,749,772 (GRCm39) Q121R probably damaging Het
Dis3 A G 14: 99,335,026 (GRCm39) F192S probably benign Het
Ect2l C T 10: 18,020,383 (GRCm39) S487N probably benign Het
Eml1 T A 12: 108,487,655 (GRCm39) F524L possibly damaging Het
Espl1 T C 15: 102,213,477 (GRCm39) I601T probably benign Het
Fbxo40 C A 16: 36,789,713 (GRCm39) V466L probably damaging Het
Frmpd1 C T 4: 45,283,711 (GRCm39) T844M probably damaging Het
Frs2 T A 10: 116,917,011 (GRCm39) probably benign Het
Fuom G T 7: 139,679,521 (GRCm39) T133K probably benign Het
Garnl3 T A 2: 32,895,212 (GRCm39) H619L probably damaging Het
Gm4861 G T 3: 137,257,876 (GRCm39) N36K unknown Het
Gps2 G T 11: 69,806,195 (GRCm39) M153I probably benign Het
Gtf2ird1 A G 5: 134,444,099 (GRCm39) V52A probably damaging Het
Gtpbp8 A T 16: 44,565,785 (GRCm39) D137E probably benign Het
Haus4 A G 14: 54,781,733 (GRCm39) C213R probably damaging Het
Hdc T A 2: 126,448,317 (GRCm39) H142L possibly damaging Het
Hephl1 T C 9: 14,965,283 (GRCm39) D1069G possibly damaging Het
Herc6 T A 6: 57,602,926 (GRCm39) V535D probably damaging Het
Hipk3 A T 2: 104,260,533 (GRCm39) H1082Q possibly damaging Het
Hps5 A T 7: 46,422,691 (GRCm39) V513D probably damaging Het
Ifna13 T A 4: 88,562,412 (GRCm39) I71F probably damaging Het
Il1rl2 T C 1: 40,402,484 (GRCm39) I426T probably damaging Het
Irf5 A T 6: 29,536,738 (GRCm39) D483V probably benign Het
Jakmip3 A G 7: 138,621,867 (GRCm39) R256G probably damaging Het
Jazf1 T C 6: 52,754,600 (GRCm39) I159V probably damaging Het
Kmo A G 1: 175,479,154 (GRCm39) D230G possibly damaging Het
Lrrc74b A G 16: 17,371,058 (GRCm39) V213A probably benign Het
LTO1 A G 7: 144,470,205 (GRCm39) S45G probably damaging Het
Ly6g5b T C 17: 35,333,704 (GRCm39) D36G possibly damaging Het
Mab21l4 T C 1: 93,079,730 (GRCm39) *453W probably null Het
Macc1 T G 12: 119,409,466 (GRCm39) L78R probably damaging Het
Mettl4 A T 17: 95,055,285 (GRCm39) D51E possibly damaging Het
Mfap1a G A 2: 121,332,835 (GRCm39) L199F possibly damaging Het
Mmp17 G T 5: 129,679,190 (GRCm39) R363L probably damaging Het
Mrc1 G A 2: 14,324,052 (GRCm39) A1130T possibly damaging Het
Mrpl15 C T 1: 4,847,805 (GRCm39) A165T probably damaging Het
Mrpl45 G A 11: 97,206,770 (GRCm39) probably null Het
Ms4a3 C T 19: 11,613,204 (GRCm39) A85T possibly damaging Het
Mttp A T 3: 137,830,882 (GRCm39) D77E probably benign Het
Muc6 A G 7: 141,217,011 (GRCm39) L2489P probably damaging Het
Myl3 G A 9: 110,595,802 (GRCm39) E100K probably damaging Het
Nbea T A 3: 55,992,743 (GRCm39) N288Y probably damaging Het
Ncoa7 A G 10: 30,574,166 (GRCm39) V181A probably benign Het
Oat C T 7: 132,159,934 (GRCm39) V429M probably benign Het
Or2ak6 A T 11: 58,593,449 (GRCm39) *307C probably null Het
Or4x6 T G 2: 89,949,427 (GRCm39) I172L probably damaging Het
Or5d36 A T 2: 87,901,300 (GRCm39) L142Q probably damaging Het
Or5p80 T C 7: 108,230,045 (GRCm39) I282T probably benign Het
Or5w19 G A 2: 87,698,805 (GRCm39) V157I probably benign Het
Or6b13 A G 7: 139,782,144 (GRCm39) F180L probably benign Het
Or6c69b T A 10: 129,626,759 (GRCm39) K233M probably damaging Het
Or8b55 A G 9: 38,727,146 (GRCm39) T116A probably benign Het
Or8s16 T A 15: 98,211,261 (GRCm39) M57L probably damaging Het
Otof A G 5: 30,533,713 (GRCm39) S1464P probably benign Het
Otogl A T 10: 107,613,436 (GRCm39) Y2010N probably damaging Het
Pgap3 C T 11: 98,291,040 (GRCm39) probably null Het
Pgbd5 T A 8: 125,100,988 (GRCm39) K332* probably null Het
Pgs1 C T 11: 117,896,553 (GRCm39) P410L probably damaging Het
Pkhd1l1 G A 15: 44,363,434 (GRCm39) S618N probably benign Het
Pola2 T A 19: 6,001,208 (GRCm39) T309S probably benign Het
Polg2 T A 11: 106,669,787 (GRCm39) H161L probably damaging Het
Postn T A 3: 54,285,033 (GRCm39) probably null Het
Ppt1 G T 4: 122,739,784 (GRCm39) C128F probably damaging Het
Ptpn12 G A 5: 21,198,261 (GRCm39) P678S probably damaging Het
Rcan3 A T 4: 135,139,812 (GRCm39) probably null Het
Rgs22 T C 15: 36,101,950 (GRCm39) N216S probably benign Het
Rgs7bp T A 13: 105,088,090 (GRCm39) D228V probably damaging Het
Rhobtb2 A T 14: 70,034,062 (GRCm39) S388T probably benign Het
Rnps1 C T 17: 24,639,364 (GRCm39) R138C unknown Het
Rpl38 T C 11: 114,562,602 (GRCm39) V36A probably benign Het
Rps7 G T 12: 28,681,752 (GRCm39) H126Q possibly damaging Het
Sec24b G T 3: 129,785,010 (GRCm39) Q999K possibly damaging Het
Slc19a3 A G 1: 82,997,089 (GRCm39) V373A possibly damaging Het
Spats2l T A 1: 57,924,941 (GRCm39) V113E probably benign Het
Ss18l1 A T 2: 179,705,138 (GRCm39) T377S unknown Het
Surf1 A G 2: 26,805,982 (GRCm39) F38L probably benign Het
Ticrr G A 7: 79,325,142 (GRCm39) R556H probably damaging Het
Tmem184b A G 15: 79,250,014 (GRCm39) S254P probably damaging Het
Tnfrsf4 G T 4: 156,100,692 (GRCm39) R237L possibly damaging Het
Tnk2 C A 16: 32,482,560 (GRCm39) probably benign Het
Tnks A T 8: 35,305,684 (GRCm39) D1191E probably damaging Het
Tnr C A 1: 159,722,607 (GRCm39) Y1017* probably null Het
Tomm34 A G 2: 163,902,926 (GRCm39) I128T probably benign Het
Trim2 G A 3: 84,085,099 (GRCm39) S540F possibly damaging Het
Trio A T 15: 27,732,977 (GRCm39) I2968N probably damaging Het
Ttc24 T C 3: 87,982,181 (GRCm39) E17G probably benign Het
Ttc41 A G 10: 86,612,078 (GRCm39) H1117R probably benign Het
Ttn A T 2: 76,565,752 (GRCm39) V28200D probably damaging Het
Ttn A T 2: 76,592,730 (GRCm39) S20801T possibly damaging Het
Ube3d C T 9: 86,330,840 (GRCm39) C114Y probably damaging Het
Ugt2b37 A C 5: 87,388,716 (GRCm39) L499R probably damaging Het
Vmn1r81 T C 7: 11,994,589 (GRCm39) I6M possibly damaging Het
Vmn2r97 A T 17: 19,149,593 (GRCm39) Y327F probably benign Het
Vps13b T C 15: 35,709,653 (GRCm39) S1867P probably damaging Het
Wdr11 T C 7: 129,208,331 (GRCm39) V362A probably benign Het
Zan T A 5: 137,387,201 (GRCm39) M4951L unknown Het
Zcwpw1 T A 5: 137,809,884 (GRCm39) L337Q probably damaging Het
Zfp2 A T 11: 50,790,809 (GRCm39) D411E possibly damaging Het
Zfp628 C T 7: 4,923,767 (GRCm39) T663I probably benign Het
Zfpm1 T A 8: 123,061,663 (GRCm39) probably null Het
Zfyve19 T C 2: 119,041,693 (GRCm39) S87P probably benign Het
Zswim9 T A 7: 12,994,141 (GRCm39) K672* probably null Het
Other mutations in Plcb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00510:Plcb1 APN 2 135,093,676 (GRCm39) missense possibly damaging 0.66
IGL01152:Plcb1 APN 2 134,655,579 (GRCm39) missense probably damaging 1.00
IGL01945:Plcb1 APN 2 135,062,711 (GRCm39) missense probably benign 0.03
IGL01999:Plcb1 APN 2 135,188,238 (GRCm39) missense probably damaging 1.00
IGL02109:Plcb1 APN 2 134,628,479 (GRCm39) missense probably damaging 1.00
IGL02153:Plcb1 APN 2 135,229,773 (GRCm39) missense probably benign 0.08
IGL02207:Plcb1 APN 2 135,229,091 (GRCm39) missense probably damaging 1.00
IGL02566:Plcb1 APN 2 135,314,183 (GRCm39) missense probably benign 0.17
IGL02590:Plcb1 APN 2 135,136,784 (GRCm39) missense probably benign 0.08
IGL02640:Plcb1 APN 2 135,062,779 (GRCm39) splice site probably benign
IGL02926:Plcb1 APN 2 135,206,682 (GRCm39) splice site probably benign
IGL03071:Plcb1 APN 2 135,229,722 (GRCm39) missense probably damaging 1.00
IGL03236:Plcb1 APN 2 135,188,226 (GRCm39) missense probably damaging 1.00
IGL03252:Plcb1 APN 2 135,212,348 (GRCm39) missense probably benign
IGL03387:Plcb1 APN 2 134,655,606 (GRCm39) splice site probably benign
BB001:Plcb1 UTSW 2 135,201,613 (GRCm39) missense probably benign 0.00
BB011:Plcb1 UTSW 2 135,201,613 (GRCm39) missense probably benign 0.00
R0024:Plcb1 UTSW 2 135,204,345 (GRCm39) missense probably benign 0.06
R0024:Plcb1 UTSW 2 135,204,345 (GRCm39) missense probably benign 0.06
R0053:Plcb1 UTSW 2 135,136,835 (GRCm39) missense probably benign 0.33
R0053:Plcb1 UTSW 2 135,136,835 (GRCm39) missense probably benign 0.33
R0308:Plcb1 UTSW 2 134,655,534 (GRCm39) missense probably benign 0.01
R0415:Plcb1 UTSW 2 135,179,419 (GRCm39) missense probably damaging 1.00
R0624:Plcb1 UTSW 2 135,136,831 (GRCm39) missense possibly damaging 0.81
R0898:Plcb1 UTSW 2 135,229,063 (GRCm39) missense possibly damaging 0.73
R1071:Plcb1 UTSW 2 135,167,577 (GRCm39) missense possibly damaging 0.64
R1615:Plcb1 UTSW 2 135,204,364 (GRCm39) splice site probably benign
R1617:Plcb1 UTSW 2 135,179,361 (GRCm39) missense probably damaging 1.00
R1785:Plcb1 UTSW 2 135,167,587 (GRCm39) nonsense probably null
R1866:Plcb1 UTSW 2 135,186,093 (GRCm39) missense probably benign 0.01
R1869:Plcb1 UTSW 2 135,152,934 (GRCm39) missense probably benign 0.02
R1902:Plcb1 UTSW 2 134,655,533 (GRCm39) missense possibly damaging 0.93
R2016:Plcb1 UTSW 2 135,204,340 (GRCm39) missense possibly damaging 0.94
R2017:Plcb1 UTSW 2 135,204,340 (GRCm39) missense possibly damaging 0.94
R2131:Plcb1 UTSW 2 135,167,587 (GRCm39) nonsense probably null
R2132:Plcb1 UTSW 2 135,167,587 (GRCm39) nonsense probably null
R2133:Plcb1 UTSW 2 135,167,587 (GRCm39) nonsense probably null
R2164:Plcb1 UTSW 2 135,188,250 (GRCm39) missense possibly damaging 0.87
R2419:Plcb1 UTSW 2 135,104,020 (GRCm39) splice site probably benign
R2429:Plcb1 UTSW 2 135,179,362 (GRCm39) missense probably damaging 0.99
R2508:Plcb1 UTSW 2 135,102,428 (GRCm39) missense probably benign 0.27
R3161:Plcb1 UTSW 2 135,177,402 (GRCm39) missense probably benign 0.03
R3870:Plcb1 UTSW 2 135,167,591 (GRCm39) missense probably damaging 0.99
R4191:Plcb1 UTSW 2 135,187,010 (GRCm39) missense probably damaging 1.00
R4239:Plcb1 UTSW 2 135,186,078 (GRCm39) missense probably damaging 0.99
R4552:Plcb1 UTSW 2 135,177,413 (GRCm39) missense probably benign 0.44
R4553:Plcb1 UTSW 2 135,177,413 (GRCm39) missense probably benign 0.44
R4720:Plcb1 UTSW 2 135,093,667 (GRCm39) missense possibly damaging 0.70
R4946:Plcb1 UTSW 2 135,187,015 (GRCm39) missense probably benign 0.01
R5012:Plcb1 UTSW 2 135,175,320 (GRCm39) missense probably null 0.97
R5151:Plcb1 UTSW 2 135,104,165 (GRCm39) missense probably benign 0.28
R5320:Plcb1 UTSW 2 135,094,696 (GRCm39) missense possibly damaging 0.56
R5415:Plcb1 UTSW 2 135,189,322 (GRCm39) missense possibly damaging 0.67
R5523:Plcb1 UTSW 2 135,102,486 (GRCm39) missense probably benign 0.08
R5568:Plcb1 UTSW 2 135,212,513 (GRCm39) missense probably damaging 1.00
R5688:Plcb1 UTSW 2 135,177,400 (GRCm39) missense probably benign 0.06
R5809:Plcb1 UTSW 2 135,104,164 (GRCm39) missense possibly damaging 0.83
R6237:Plcb1 UTSW 2 135,212,486 (GRCm39) missense possibly damaging 0.94
R6315:Plcb1 UTSW 2 135,188,261 (GRCm39) missense probably benign 0.00
R6478:Plcb1 UTSW 2 135,177,371 (GRCm39) missense probably damaging 1.00
R6531:Plcb1 UTSW 2 135,167,722 (GRCm39) critical splice donor site probably null
R6683:Plcb1 UTSW 2 134,628,513 (GRCm39) missense probably benign 0.32
R6760:Plcb1 UTSW 2 135,313,980 (GRCm39) missense possibly damaging 0.50
R6947:Plcb1 UTSW 2 135,228,075 (GRCm39) missense probably benign 0.08
R6976:Plcb1 UTSW 2 135,104,159 (GRCm39) missense possibly damaging 0.75
R7379:Plcb1 UTSW 2 135,212,430 (GRCm39) missense probably benign 0.45
R7473:Plcb1 UTSW 2 135,186,196 (GRCm39) missense probably damaging 0.98
R7492:Plcb1 UTSW 2 135,093,684 (GRCm39) nonsense probably null
R7498:Plcb1 UTSW 2 135,104,154 (GRCm39) missense probably damaging 0.99
R7498:Plcb1 UTSW 2 135,104,153 (GRCm39) nonsense probably null
R7777:Plcb1 UTSW 2 135,062,677 (GRCm39) missense possibly damaging 0.51
R7924:Plcb1 UTSW 2 135,201,613 (GRCm39) missense probably benign 0.00
R8061:Plcb1 UTSW 2 135,188,316 (GRCm39) missense probably benign
R8099:Plcb1 UTSW 2 135,093,654 (GRCm39) missense possibly damaging 0.68
R8299:Plcb1 UTSW 2 135,177,396 (GRCm39) missense probably damaging 1.00
R8394:Plcb1 UTSW 2 135,159,710 (GRCm39) missense probably damaging 1.00
R8439:Plcb1 UTSW 2 135,091,972 (GRCm39) critical splice donor site probably null
R8549:Plcb1 UTSW 2 135,206,853 (GRCm39) missense probably benign 0.00
R8693:Plcb1 UTSW 2 135,094,696 (GRCm39) missense probably benign 0.00
R8750:Plcb1 UTSW 2 135,177,369 (GRCm39) missense probably damaging 1.00
R8817:Plcb1 UTSW 2 135,175,429 (GRCm39) intron probably benign
R8950:Plcb1 UTSW 2 135,179,439 (GRCm39) missense probably damaging 1.00
R9146:Plcb1 UTSW 2 135,182,615 (GRCm39) missense probably damaging 1.00
R9301:Plcb1 UTSW 2 135,167,610 (GRCm39) missense possibly damaging 0.96
R9311:Plcb1 UTSW 2 135,189,385 (GRCm39) missense probably benign 0.00
R9459:Plcb1 UTSW 2 135,164,558 (GRCm39) missense probably benign 0.03
S24628:Plcb1 UTSW 2 135,179,419 (GRCm39) missense probably damaging 1.00
X0025:Plcb1 UTSW 2 135,186,974 (GRCm39) missense possibly damaging 0.87
Z1088:Plcb1 UTSW 2 135,062,766 (GRCm39) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GTGATCACAGAAAACATCAAACTGG -3'
(R):5'- AGAGACTTTATGAAGGGGCCAT -3'

Sequencing Primer
(F):5'- CCCAGCTTATTCAGAAGTTGACAG -3'
(R):5'- GCCATTGGTTAAGACACTGC -3'
Posted On 2014-07-14