Mutagenetix > Incidental Mutation

Incidental Mutation 'R1938:Nbea'

213644

Institutional Source

Beutler Lab

Gene Symbol

Nbea

Ensembl Gene

ENSMUSG00000027799

Gene Name

neurobeachin

Synonyms

MMRRC Submission

039956-MU

Accession Numbers

Genbank: NM_030595

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1938 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

55625195-56183701 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 56085322 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Tyrosine at position 288 (N288Y)

Ref Sequence

ENSEMBL: ENSMUSP00000029374 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029374]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000029374
AA Change: N288Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000029374
Gene: ENSMUSG00000027799
AA Change: N288Y

Domain	Start	End	E-Value	Type
low complexity region	19	40	N/A	INTRINSIC
Pfam:Laminin_G_3	228	393	2.8e-13	PFAM
Pfam:DUF4704	462	733	4e-113	PFAM
low complexity region	792	802	N/A	INTRINSIC
low complexity region	964	969	N/A	INTRINSIC
low complexity region	1781	1790	N/A	INTRINSIC
low complexity region	1791	1807	N/A	INTRINSIC
low complexity region	1835	1845	N/A	INTRINSIC
Pfam:DUF1088	1956	2122	3.5e-91	PFAM
Pfam:PH_BEACH	2148	2245	2.6e-32	PFAM
Beach	2276	2553	1.3e-205	SMART
WD40	2659	2696	2.12e2	SMART
WD40	2699	2742	2.22e0	SMART
WD40	2759	2798	9.21e0	SMART
WD40	2842	2880	2.88e-1	SMART
WD40	2883	2922	8.91e-1	SMART

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.4%
20x: 92.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a large, diverse group of A-kinase anchor proteins that target the activity of protein kinase A to specific subcellular sites by binding to its type II regulatory subunits. Brain-specific expression and coat protein-like membrane recruitment of a highly similar protein in mouse suggest an involvement in neuronal post-Golgi membrane traffic. Mutations in this gene may be associated with a form of autism. This gene and its expression are frequently disrupted in patients with multiple myeloma. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Additional transcript variants may exist, but their full-length nature has not been determined.[provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele or transgene insertion die shortly after birth, are cyanotic, and exhibit no response to tactile stimuli, no spontaneous movement, and impaired CNS synaptic transmission. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Gene trapped(3) Transgenic(1)

Other mutations in this stock

Total: 133 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310007B03Rik	T	C	1: 93,152,008	*453W	probably null	Het
Abcc8	T	C	7: 46,175,371	K134R	possibly damaging	Het
Adamts17	T	C	7: 67,125,072	S980P	probably damaging	Het
Adap2	T	A	11: 80,170,682	I221K	probably damaging	Het
Adgrv1	C	T	13: 81,391,757	R5681Q	probably damaging	Het
Adipor1	T	A	1: 134,423,103	L30Q	probably benign	Het
Agpat5	A	G	8: 18,878,165	T249A	probably benign	Het
Agxt2	G	T	15: 10,391,935	G329V	probably damaging	Het
Ankrd28	A	G	14: 31,705,276	V801A	possibly damaging	Het
Ap1g2	A	G	14: 55,099,772	V702A	possibly damaging	Het
Arid3a	A	G	10: 79,950,706	Q429R	probably damaging	Het
Arsb	T	A	13: 93,862,150	L322Q	probably damaging	Het
Ash1l	A	G	3: 88,984,422	T1203A	probably damaging	Het
Atad2	T	A	15: 58,096,705	N1308Y	possibly damaging	Het
Atp10b	A	T	11: 43,230,418	R969S	probably benign	Het
Bmp10	T	C	6: 87,433,720	I165T	possibly damaging	Het
Ccne1	A	G	7: 38,106,277		probably null	Het
Cenpe	A	G	3: 135,247,479	N1565D	probably damaging	Het
Chd1	A	T	17: 15,762,486	E1404D	probably benign	Het
Chd7	G	A	4: 8,847,200	E1648K	probably damaging	Het
Chodl	T	C	16: 78,941,426	I94T	possibly damaging	Het
Chsy3	T	C	18: 59,409,512	F574S	probably damaging	Het
Clpb	A	T	7: 101,763,656	I317F	probably damaging	Het
Cnga3	T	A	1: 37,261,873	V558D	possibly damaging	Het
Col9a1	C	T	1: 24,222,473	P573S	probably damaging	Het
Crat	A	T	2: 30,413,061	D71E	probably benign	Het
Cspg4	A	G	9: 56,887,101	T707A	probably benign	Het
Ctsr	T	A	13: 61,162,445	R132S	probably benign	Het
Ctu2	T	C	8: 122,479,285	L255P	probably damaging	Het
Cyp2c69	T	C	19: 39,849,366	Y424C	probably damaging	Het
Ddx27	A	T	2: 167,034,109	K726N	probably damaging	Het
Dennd4a	A	G	9: 64,842,490	Q121R	probably damaging	Het
Dis3	A	G	14: 99,097,590	F192S	probably benign	Het
Ect2l	C	T	10: 18,144,635	S487N	probably benign	Het
Eml1	T	A	12: 108,521,396	F524L	possibly damaging	Het
Espl1	T	C	15: 102,305,042	I601T	probably benign	Het
Fbxo40	C	A	16: 36,969,351	V466L	probably damaging	Het
Frmpd1	C	T	4: 45,283,711	T844M	probably damaging	Het
Frs2	T	A	10: 117,081,106		probably benign	Het
Fuom	G	T	7: 140,099,608	T133K	probably benign	Het
Garnl3	T	A	2: 33,005,200	H619L	probably damaging	Het
Gm4861	G	T	3: 137,552,115	N36K	unknown	Het
Gm6588	C	A	5: 112,449,801	C71*	probably null	Het
Gps2	G	T	11: 69,915,369	M153I	probably benign	Het
Gtf2ird1	A	G	5: 134,415,245	V52A	probably damaging	Het
Gtpbp8	A	T	16: 44,745,422	D137E	probably benign	Het
Haus4	A	G	14: 54,544,276	C213R	probably damaging	Het
Hdc	T	A	2: 126,606,397	H142L	possibly damaging	Het
Hephl1	T	C	9: 15,053,987	D1069G	possibly damaging	Het
Herc6	T	A	6: 57,625,941	V535D	probably damaging	Het
Hipk3	A	T	2: 104,430,188	H1082Q	possibly damaging	Het
Hps5	A	T	7: 46,773,267	V513D	probably damaging	Het
Ifna13	T	A	4: 88,644,175	I71F	probably damaging	Het
Il1rl2	T	C	1: 40,363,324	I426T	probably damaging	Het
Irf5	A	T	6: 29,536,739	D483V	probably benign	Het
Jakmip3	A	G	7: 139,020,138	R256G	probably damaging	Het
Jazf1	T	C	6: 52,777,615	I159V	probably damaging	Het
Kmo	A	G	1: 175,651,588	D230G	possibly damaging	Het
Lrrc74b	A	G	16: 17,553,194	V213A	probably benign	Het
Ly6g5b	T	C	17: 35,114,728	D36G	possibly damaging	Het
Macc1	T	G	12: 119,445,731	L78R	probably damaging	Het
Mettl4	A	T	17: 94,747,857	D51E	possibly damaging	Het
Mfap1a	G	A	2: 121,502,354	L199F	possibly damaging	Het
Mmp17	G	T	5: 129,602,126	R363L	probably damaging	Het
Mrc1	G	A	2: 14,319,241	A1130T	possibly damaging	Het
Mrpl15	C	T	1: 4,777,582	A165T	probably damaging	Het
Mrpl45	G	A	11: 97,315,944		probably null	Het
Ms4a3	C	T	19: 11,635,840	A85T	possibly damaging	Het
Mttp	A	T	3: 138,125,121	D77E	probably benign	Het
Muc6	A	G	7: 141,637,098	L2489P	probably damaging	Het
Myl3	G	A	9: 110,766,734	E100K	probably damaging	Het
Ncoa7	A	G	10: 30,698,170	V181A	probably benign	Het
Oat	C	T	7: 132,558,205	V429M	probably benign	Het
Olfr1152	G	A	2: 87,868,461	V157I	probably benign	Het
Olfr1163	A	T	2: 88,070,956	L142Q	probably damaging	Het
Olfr1269	T	G	2: 90,119,083	I172L	probably damaging	Het
Olfr285	T	A	15: 98,313,380	M57L	probably damaging	Het
Olfr319	A	T	11: 58,702,623	*307C	probably null	Het
Olfr508	T	C	7: 108,630,838	I282T	probably benign	Het
Olfr524	A	G	7: 140,202,231	F180L	probably benign	Het
Olfr810	T	A	10: 129,790,890	K233M	probably damaging	Het
Olfr922	A	G	9: 38,815,850	T116A	probably benign	Het
Oraov1	A	G	7: 144,916,468	S45G	probably damaging	Het
Otof	A	G	5: 30,376,369	S1464P	probably benign	Het
Otogl	A	T	10: 107,777,575	Y2010N	probably damaging	Het
Pgap3	C	T	11: 98,400,214		probably null	Het
Pgbd5	T	A	8: 124,374,249	K332*	probably null	Het
Pgs1	C	T	11: 118,005,727	P410L	probably damaging	Het
Pkhd1l1	G	A	15: 44,500,038	S618N	probably benign	Het
Plcb1	A	T	2: 135,386,302	D1073V	probably damaging	Het
Pola2	T	A	19: 5,951,180	T309S	probably benign	Het
Polg2	T	A	11: 106,778,961	H161L	probably damaging	Het
Postn	T	A	3: 54,377,612		probably null	Het
Ppt1	G	T	4: 122,845,991	C128F	probably damaging	Het
Ptpn12	G	A	5: 20,993,263	P678S	probably damaging	Het
Rcan3	A	T	4: 135,412,501		probably null	Het
Rgs22	T	C	15: 36,101,804	N216S	probably benign	Het
Rgs7bp	T	A	13: 104,951,582	D228V	probably damaging	Het
Rhobtb2	A	T	14: 69,796,613	S388T	probably benign	Het
Rnps1	C	T	17: 24,420,390	R138C	unknown	Het
Rpl38	T	C	11: 114,671,776	V36A	probably benign	Het
Rps7	G	T	12: 28,631,753	H126Q	possibly damaging	Het
Sec24b	G	T	3: 129,991,361	Q999K	possibly damaging	Het
Slc19a3	A	G	1: 83,019,368	V373A	possibly damaging	Het
Spats2l	T	A	1: 57,885,782	V113E	probably benign	Het
Ss18l1	A	T	2: 180,063,345	T377S	unknown	Het
Surf1	A	G	2: 26,915,970	F38L	probably benign	Het
Ticrr	G	A	7: 79,675,394	R556H	probably damaging	Het
Tmem184b	A	G	15: 79,365,814	S254P	probably damaging	Het
Tnfrsf4	G	T	4: 156,016,235	R237L	possibly damaging	Het
Tnk2	C	A	16: 32,663,742		probably benign	Het
Tnks	A	T	8: 34,838,530	D1191E	probably damaging	Het
Tnr	C	A	1: 159,895,037	Y1017*	probably null	Het
Tomm34	A	G	2: 164,061,006	I128T	probably benign	Het
Trim2	G	A	3: 84,177,792	S540F	possibly damaging	Het
Trio	A	T	15: 27,732,891	I2968N	probably damaging	Het
Ttc24	T	C	3: 88,074,874	E17G	probably benign	Het
Ttc41	A	G	10: 86,776,214	H1117R	probably benign	Het
Ttn	A	T	2: 76,735,408	V28200D	probably damaging	Het
Ttn	A	T	2: 76,762,386	S20801T	possibly damaging	Het
Ube2cbp	C	T	9: 86,448,787	C114Y	probably damaging	Het
Ugt2b37	A	C	5: 87,240,857	L499R	probably damaging	Het
Vmn1r81	T	C	7: 12,260,662	I6M	possibly damaging	Het
Vmn2r97	A	T	17: 18,929,331	Y327F	probably benign	Het
Vps13b	T	C	15: 35,709,507	S1867P	probably damaging	Het
Wdr11	T	C	7: 129,606,607	V362A	probably benign	Het
Zan	T	A	5: 137,388,939	M4951L	unknown	Het
Zcwpw1	T	A	5: 137,811,622	L337Q	probably damaging	Het
Zfp2	A	T	11: 50,899,982	D411E	possibly damaging	Het
Zfp628	C	T	7: 4,920,768	T663I	probably benign	Het
Zfpm1	T	A	8: 122,334,924		probably null	Het
Zfyve19	T	C	2: 119,211,212	S87P	probably benign	Het
Zswim9	T	A	7: 13,260,214	K672*	probably null	Het

Other mutations in Nbea

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00540:Nbea	APN	3	55628493	missense	probably damaging	1.00
IGL00541:Nbea	APN	3	55968089	missense	probably benign	0.02
IGL00584:Nbea	APN	3	56082448	missense	probably damaging	0.98
IGL00648:Nbea	APN	3	56009260	missense	probably damaging	0.98
IGL00785:Nbea	APN	3	55955393	missense	probably benign
IGL00899:Nbea	APN	3	55642845	missense	probably benign	0.32
IGL00955:Nbea	APN	3	56005472	missense	possibly damaging	0.45
IGL01296:Nbea	APN	3	56031536	missense	probably benign	0.04
IGL01299:Nbea	APN	3	55690894	missense	probably damaging	1.00
IGL01393:Nbea	APN	3	56005308	missense	probably benign	0.02
IGL01550:Nbea	APN	3	55805248	missense	possibly damaging	0.93
IGL02023:Nbea	APN	3	55681016	missense	probably damaging	1.00
IGL02034:Nbea	APN	3	55968156	missense	probably damaging	1.00
IGL02061:Nbea	APN	3	55717887	missense	possibly damaging	0.54
IGL02082:Nbea	APN	3	55968167	missense	possibly damaging	0.88
IGL02113:Nbea	APN	3	55992492	missense	probably benign
IGL02188:Nbea	APN	3	55983837	missense	probably benign	0.00
IGL02319:Nbea	APN	3	55985738	missense	probably damaging	1.00
IGL02406:Nbea	APN	3	56086266	missense	probably benign	0.02
IGL02494:Nbea	APN	3	55805351	missense	probably benign	0.02
IGL02550:Nbea	APN	3	56019414	missense	probably damaging	0.98
IGL02706:Nbea	APN	3	56037278	missense	probably damaging	1.00
IGL02718:Nbea	APN	3	55632062	nonsense	probably null
IGL02822:Nbea	APN	3	56019447	missense	possibly damaging	0.93
IGL02885:Nbea	APN	3	55631986	missense	probably benign	0.01
IGL03000:Nbea	APN	3	56004627	missense	possibly damaging	0.94
IGL03081:Nbea	APN	3	56079918	missense	probably damaging	1.00
IGL03091:Nbea	APN	3	56085304	missense	probably damaging	1.00
IGL03368:Nbea	APN	3	56079930	missense	probably damaging	0.98
Neches	UTSW	3	55953034	critical splice donor site	probably null
scotland	UTSW	3	55626908	missense	probably damaging	1.00
Wales	UTSW	3	56091119	missense	probably damaging	1.00
FR4340:Nbea	UTSW	3	56009212	critical splice donor site	probably benign
G4846:Nbea	UTSW	3	56087497	missense	probably damaging	0.98
IGL02835:Nbea	UTSW	3	55717869	missense	possibly damaging	0.88
LCD18:Nbea	UTSW	3	55701527	intron	probably benign
R0087:Nbea	UTSW	3	56091023	missense	possibly damaging	0.92
R0220:Nbea	UTSW	3	56005303	missense	probably benign	0.30
R0324:Nbea	UTSW	3	56057948	critical splice donor site	probably null
R0330:Nbea	UTSW	3	55642817	missense	probably benign	0.27
R0391:Nbea	UTSW	3	56037277	missense	probably damaging	1.00
R0394:Nbea	UTSW	3	56029907	missense	probably damaging	1.00
R0419:Nbea	UTSW	3	55819294	missense	probably benign	0.05
R0503:Nbea	UTSW	3	55642836	missense	possibly damaging	0.79
R0521:Nbea	UTSW	3	56008268	missense	probably damaging	1.00
R0595:Nbea	UTSW	3	55628496	missense	probably benign	0.18
R0894:Nbea	UTSW	3	56009340	missense	possibly damaging	0.89
R1072:Nbea	UTSW	3	56086196	missense	possibly damaging	0.94
R1125:Nbea	UTSW	3	55857006	nonsense	probably null
R1169:Nbea	UTSW	3	55968323	missense	probably benign	0.00
R1241:Nbea	UTSW	3	56058040	missense	probably damaging	1.00
R1269:Nbea	UTSW	3	56004781	missense	probably benign	0.05
R1406:Nbea	UTSW	3	56037281	missense	probably benign	0.00
R1406:Nbea	UTSW	3	56037281	missense	probably benign	0.00
R1457:Nbea	UTSW	3	56085327	missense	probably damaging	1.00
R1482:Nbea	UTSW	3	56079993	missense	probably damaging	1.00
R1483:Nbea	UTSW	3	56002790	missense	probably benign	0.25
R1502:Nbea	UTSW	3	56004889	missense	probably benign	0.03
R1544:Nbea	UTSW	3	56058827	missense	probably damaging	0.99
R1629:Nbea	UTSW	3	56002891	missense	possibly damaging	0.52
R1647:Nbea	UTSW	3	55630229	missense	probably damaging	0.97
R1663:Nbea	UTSW	3	55645986	missense	possibly damaging	0.95
R1722:Nbea	UTSW	3	55665695	missense	probably damaging	1.00
R1757:Nbea	UTSW	3	55630189	missense	possibly damaging	0.83
R1771:Nbea	UTSW	3	55934519	missense	probably benign	0.00
R1796:Nbea	UTSW	3	55643708	missense	possibly damaging	0.48
R1844:Nbea	UTSW	3	56082436	missense	probably damaging	0.97
R1872:Nbea	UTSW	3	55642889	missense	probably benign	0.12
R1940:Nbea	UTSW	3	55953100	missense	possibly damaging	0.78
R2062:Nbea	UTSW	3	56086157	splice site	probably benign
R2066:Nbea	UTSW	3	55968146	missense	probably damaging	1.00
R2097:Nbea	UTSW	3	55723217	missense	probably damaging	0.96
R2181:Nbea	UTSW	3	56029939	missense	possibly damaging	0.92
R2274:Nbea	UTSW	3	55988085	splice site	probably null
R2345:Nbea	UTSW	3	56085279	missense	probably damaging	1.00
R2423:Nbea	UTSW	3	56085306	missense	probably damaging	1.00
R2434:Nbea	UTSW	3	55647460	missense	possibly damaging	0.91
R2880:Nbea	UTSW	3	55647358	missense	probably benign	0.04
R2881:Nbea	UTSW	3	55647358	missense	probably benign	0.04
R2940:Nbea	UTSW	3	55934624	missense	probably benign	0.24
R3500:Nbea	UTSW	3	55681010	missense	possibly damaging	0.88
R3765:Nbea	UTSW	3	56005549	missense	probably damaging	1.00
R3790:Nbea	UTSW	3	56005029	missense	probably benign
R3808:Nbea	UTSW	3	55717848	missense	probably benign	0.02
R3845:Nbea	UTSW	3	56086292	splice site	probably benign
R4182:Nbea	UTSW	3	56008427	missense	probably damaging	0.99
R4385:Nbea	UTSW	3	56000638	missense	possibly damaging	0.77
R4419:Nbea	UTSW	3	56009600	missense	probably damaging	1.00
R4426:Nbea	UTSW	3	56082379	missense	probably damaging	0.98
R4451:Nbea	UTSW	3	55992332	critical splice donor site	probably null
R4456:Nbea	UTSW	3	55643784	missense	probably benign	0.00
R4604:Nbea	UTSW	3	55723648	missense	probably benign	0.18
R4687:Nbea	UTSW	3	56058065	missense	probably damaging	1.00
R4758:Nbea	UTSW	3	56005403	missense	probably benign
R4840:Nbea	UTSW	3	55710670	missense	probably benign	0.37
R4888:Nbea	UTSW	3	56005355	missense	possibly damaging	0.61
R4954:Nbea	UTSW	3	56035958	missense	probably damaging	1.00
R4972:Nbea	UTSW	3	56085246	missense	probably damaging	0.99
R4980:Nbea	UTSW	3	55647351	splice site	probably null
R4980:Nbea	UTSW	3	55953045	missense	probably benign	0.00
R5104:Nbea	UTSW	3	56079927	missense	probably damaging	1.00
R5139:Nbea	UTSW	3	55626963	missense	possibly damaging	0.90
R5166:Nbea	UTSW	3	56019453	missense	probably damaging	1.00
R5347:Nbea	UTSW	3	56040876	missense	probably damaging	1.00
R5350:Nbea	UTSW	3	56019424	missense	probably damaging	1.00
R5418:Nbea	UTSW	3	55645989	missense	possibly damaging	0.86
R5586:Nbea	UTSW	3	55631971	missense	probably benign	0.08
R5627:Nbea	UTSW	3	55992345	missense	probably damaging	1.00
R5683:Nbea	UTSW	3	55628586	missense	possibly damaging	0.53
R5765:Nbea	UTSW	3	56005298	missense	probably benign	0.15
R5853:Nbea	UTSW	3	55992401	missense	probably damaging	1.00
R5858:Nbea	UTSW	3	55953034	critical splice donor site	probably null
R5955:Nbea	UTSW	3	55680983	missense	probably benign	0.00
R5976:Nbea	UTSW	3	55853847	missense	probably benign	0.30
R6039:Nbea	UTSW	3	56005117	missense	probably benign	0.00
R6039:Nbea	UTSW	3	56005117	missense	probably benign	0.00
R6043:Nbea	UTSW	3	55786475	missense	probably benign	0.32
R6122:Nbea	UTSW	3	56029896	missense	probably damaging	1.00
R6218:Nbea	UTSW	3	55628484	missense	probably damaging	0.97
R6331:Nbea	UTSW	3	56000616	missense	possibly damaging	0.94
R6334:Nbea	UTSW	3	56037149	missense	probably damaging	1.00
R6393:Nbea	UTSW	3	56091119	missense	probably damaging	1.00
R6411:Nbea	UTSW	3	55805357	missense	probably benign	0.01
R6457:Nbea	UTSW	3	56000569	missense	probably damaging	1.00
R6476:Nbea	UTSW	3	56004806	missense	probably benign	0.00
R6488:Nbea	UTSW	3	55717843	missense	probably damaging	0.99
R6700:Nbea	UTSW	3	56082448	missense	possibly damaging	0.89
R6702:Nbea	UTSW	3	56005502	missense	probably benign	0.06
R6752:Nbea	UTSW	3	55968309	missense	probably benign	0.02
R6752:Nbea	UTSW	3	56037219	missense	probably benign
R6804:Nbea	UTSW	3	56087453	missense	probably benign	0.37
R6901:Nbea	UTSW	3	56019415	missense	probably damaging	1.00
R6933:Nbea	UTSW	3	55723610	missense	possibly damaging	0.63
R7124:Nbea	UTSW	3	55992444	missense	probably damaging	1.00
R7211:Nbea	UTSW	3	56004901	missense	probably benign	0.05
R7308:Nbea	UTSW	3	56091031	missense	probably damaging	1.00
R7405:Nbea	UTSW	3	55805266	missense	possibly damaging	0.94
R7669:Nbea	UTSW	3	55717779	missense	probably damaging	1.00
R7762:Nbea	UTSW	3	55649705	missense	probably damaging	1.00
R7833:Nbea	UTSW	3	56002797	missense	probably damaging	1.00
R7885:Nbea	UTSW	3	55665689	missense	probably damaging	0.97
R7935:Nbea	UTSW	3	56058665	missense	probably damaging	1.00
R8050:Nbea	UTSW	3	55987981	missense	probably damaging	0.99
R8108:Nbea	UTSW	3	55819315	missense	probably benign	0.11
R8290:Nbea	UTSW	3	56058635	nonsense	probably null
R8314:Nbea	UTSW	3	56009251	missense	probably damaging	0.99
R8321:Nbea	UTSW	3	56183097	missense	possibly damaging	0.86
R8376:Nbea	UTSW	3	55643655	missense	possibly damaging	0.79
R8410:Nbea	UTSW	3	56037263	missense	probably damaging	1.00
R8556:Nbea	UTSW	3	55647386	missense	probably benign	0.25
R8753:Nbea	UTSW	3	55626908	missense	probably damaging	1.00
R8844:Nbea	UTSW	3	56090994	missense	probably damaging	0.97
R8884:Nbea	UTSW	3	55805299	missense	probably benign	0.00
R8886:Nbea	UTSW	3	56058727	missense	probably damaging	1.00
R8890:Nbea	UTSW	3	56019363	splice site	probably benign
R9004:Nbea	UTSW	3	56002938	missense	probably benign	0.01
R9022:Nbea	UTSW	3	55643689	missense	possibly damaging	0.79
R9080:Nbea	UTSW	3	56005095	nonsense	probably null
R9087:Nbea	UTSW	3	55642736	critical splice donor site	probably null
R9104:Nbea	UTSW	3	55955388	missense	probably benign
R9165:Nbea	UTSW	3	56004868	missense	probably benign	0.15
R9219:Nbea	UTSW	3	56090972	frame shift	probably null
R9221:Nbea	UTSW	3	56090972	frame shift	probably null
R9222:Nbea	UTSW	3	56090972	frame shift	probably null
R9260:Nbea	UTSW	3	55983812	missense	possibly damaging	0.50
R9263:Nbea	UTSW	3	56090972	frame shift	probably null
R9265:Nbea	UTSW	3	56090972	frame shift	probably null
R9294:Nbea	UTSW	3	56091092	missense	probably benign	0.00
R9360:Nbea	UTSW	3	56035898	missense	possibly damaging	0.96
R9387:Nbea	UTSW	3	55991039	missense	probably benign	0.12
R9428:Nbea	UTSW	3	56090972	frame shift	probably null
R9435:Nbea	UTSW	3	56035888	missense	possibly damaging	0.63
R9507:Nbea	UTSW	3	55665590	missense	probably damaging	1.00
R9514:Nbea	UTSW	3	56029945	missense	probably damaging	1.00
R9516:Nbea	UTSW	3	56029945	missense	probably damaging	1.00
R9674:Nbea	UTSW	3	56058762	missense	probably damaging	1.00
R9688:Nbea	UTSW	3	55649744	missense	probably benign	0.42
R9709:Nbea	UTSW	3	55786458	nonsense	probably null
RF051:Nbea	UTSW	3	56009212	critical splice donor site	probably benign
X0018:Nbea	UTSW	3	56036048	missense	probably benign	0.39
Z1088:Nbea	UTSW	3	55723163	missense	probably benign	0.34
Z1177:Nbea	UTSW	3	56031550	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGTGAAAGAACATTACAGAAGTCAC -3'
(R):5'- CCAAAGCCTACTATTTCTTGGGT -3'

Sequencing Primer
(F):5'- TTACAGAAGTCACACTGCACAG -3'
(R):5'- AGCCTACTATTTCTTGGGTTAAATCC -3'

Posted On

2014-07-14