Incidental Mutation 'R1938:Abcc8'
ID213684
Institutional Source Beutler Lab
Gene Symbol Abcc8
Ensembl Gene ENSMUSG00000040136
Gene NameATP-binding cassette, sub-family C (CFTR/MRP), member 8
SynonymsD930031B21Rik, SUR1, Sur
MMRRC Submission 039956-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.596) question?
Stock #R1938 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location46104523-46180033 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46175371 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 134 (K134R)
Ref Sequence ENSEMBL: ENSMUSP00000033123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033123] [ENSMUST00000210511]
Predicted Effect possibly damaging
Transcript: ENSMUST00000033123
AA Change: K134R

PolyPhen 2 Score 0.492 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000033123
Gene: ENSMUSG00000040136
AA Change: K134R

DomainStartEndE-ValueType
transmembrane domain 30 52 N/A INTRINSIC
transmembrane domain 73 95 N/A INTRINSIC
transmembrane domain 105 124 N/A INTRINSIC
transmembrane domain 131 148 N/A INTRINSIC
transmembrane domain 168 190 N/A INTRINSIC
Pfam:ABC_membrane 299 590 1.3e-39 PFAM
AAA 705 920 4.46e-14 SMART
low complexity region 972 994 N/A INTRINSIC
Pfam:ABC_membrane 1019 1301 1.3e-49 PFAM
AAA 1377 1570 4.33e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000210511
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210986
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. This protein functions as a modulator of ATP-sensitive potassium channels and insulin release. Mutations and deficiencies in this protein have been observed in patients with hyperinsulinemic hypoglycemia of infancy, an autosomal recessive disorder of unregulated and high insulin secretion. Mutations have also been associated with non-insulin-dependent diabetes mellitus type II, an autosomal dominant disease of defective insulin secretion. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygotes for targeted null mutations exhibit a transient neonatal hypoglycemia and a late-developing glucose intolerance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 133 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik T C 1: 93,152,008 *453W probably null Het
Adamts17 T C 7: 67,125,072 S980P probably damaging Het
Adap2 T A 11: 80,170,682 I221K probably damaging Het
Adgrv1 C T 13: 81,391,757 R5681Q probably damaging Het
Adipor1 T A 1: 134,423,103 L30Q probably benign Het
Agpat5 A G 8: 18,878,165 T249A probably benign Het
Agxt2 G T 15: 10,391,935 G329V probably damaging Het
Ankrd28 A G 14: 31,705,276 V801A possibly damaging Het
Ap1g2 A G 14: 55,099,772 V702A possibly damaging Het
Arid3a A G 10: 79,950,706 Q429R probably damaging Het
Arsb T A 13: 93,862,150 L322Q probably damaging Het
Ash1l A G 3: 88,984,422 T1203A probably damaging Het
Atad2 T A 15: 58,096,705 N1308Y possibly damaging Het
Atp10b A T 11: 43,230,418 R969S probably benign Het
Bmp10 T C 6: 87,433,720 I165T possibly damaging Het
Ccne1 A G 7: 38,106,277 probably null Het
Cenpe A G 3: 135,247,479 N1565D probably damaging Het
Chd1 A T 17: 15,762,486 E1404D probably benign Het
Chd7 G A 4: 8,847,200 E1648K probably damaging Het
Chodl T C 16: 78,941,426 I94T possibly damaging Het
Chsy3 T C 18: 59,409,512 F574S probably damaging Het
Clpb A T 7: 101,763,656 I317F probably damaging Het
Cnga3 T A 1: 37,261,873 V558D possibly damaging Het
Col9a1 C T 1: 24,222,473 P573S probably damaging Het
Crat A T 2: 30,413,061 D71E probably benign Het
Cspg4 A G 9: 56,887,101 T707A probably benign Het
Ctsr T A 13: 61,162,445 R132S probably benign Het
Ctu2 T C 8: 122,479,285 L255P probably damaging Het
Cyp2c69 T C 19: 39,849,366 Y424C probably damaging Het
Ddx27 A T 2: 167,034,109 K726N probably damaging Het
Dennd4a A G 9: 64,842,490 Q121R probably damaging Het
Dis3 A G 14: 99,097,590 F192S probably benign Het
Ect2l C T 10: 18,144,635 S487N probably benign Het
Eml1 T A 12: 108,521,396 F524L possibly damaging Het
Espl1 T C 15: 102,305,042 I601T probably benign Het
Fbxo40 C A 16: 36,969,351 V466L probably damaging Het
Frmpd1 C T 4: 45,283,711 T844M probably damaging Het
Frs2 T A 10: 117,081,106 probably benign Het
Fuom G T 7: 140,099,608 T133K probably benign Het
Garnl3 T A 2: 33,005,200 H619L probably damaging Het
Gm4861 G T 3: 137,552,115 N36K unknown Het
Gm6588 C A 5: 112,449,801 C71* probably null Het
Gps2 G T 11: 69,915,369 M153I probably benign Het
Gtf2ird1 A G 5: 134,415,245 V52A probably damaging Het
Gtpbp8 A T 16: 44,745,422 D137E probably benign Het
Haus4 A G 14: 54,544,276 C213R probably damaging Het
Hdc T A 2: 126,606,397 H142L possibly damaging Het
Hephl1 T C 9: 15,053,987 D1069G possibly damaging Het
Herc6 T A 6: 57,625,941 V535D probably damaging Het
Hipk3 A T 2: 104,430,188 H1082Q possibly damaging Het
Hps5 A T 7: 46,773,267 V513D probably damaging Het
Ifna13 T A 4: 88,644,175 I71F probably damaging Het
Il1rl2 T C 1: 40,363,324 I426T probably damaging Het
Irf5 A T 6: 29,536,739 D483V probably benign Het
Jakmip3 A G 7: 139,020,138 R256G probably damaging Het
Jazf1 T C 6: 52,777,615 I159V probably damaging Het
Kmo A G 1: 175,651,588 D230G possibly damaging Het
Lrrc74b A G 16: 17,553,194 V213A probably benign Het
Ly6g5b T C 17: 35,114,728 D36G possibly damaging Het
Macc1 T G 12: 119,445,731 L78R probably damaging Het
Mettl4 A T 17: 94,747,857 D51E possibly damaging Het
Mfap1a G A 2: 121,502,354 L199F possibly damaging Het
Mmp17 G T 5: 129,602,126 R363L probably damaging Het
Mrc1 G A 2: 14,319,241 A1130T possibly damaging Het
Mrpl15 C T 1: 4,777,582 A165T probably damaging Het
Mrpl45 G A 11: 97,315,944 probably null Het
Ms4a3 C T 19: 11,635,840 A85T possibly damaging Het
Mttp A T 3: 138,125,121 D77E probably benign Het
Muc6 A G 7: 141,637,098 L2489P probably damaging Het
Myl3 G A 9: 110,766,734 E100K probably damaging Het
Nbea T A 3: 56,085,322 N288Y probably damaging Het
Ncoa7 A G 10: 30,698,170 V181A probably benign Het
Oat C T 7: 132,558,205 V429M probably benign Het
Olfr1152 G A 2: 87,868,461 V157I probably benign Het
Olfr1163 A T 2: 88,070,956 L142Q probably damaging Het
Olfr1269 T G 2: 90,119,083 I172L probably damaging Het
Olfr285 T A 15: 98,313,380 M57L probably damaging Het
Olfr319 A T 11: 58,702,623 *307C probably null Het
Olfr508 T C 7: 108,630,838 I282T probably benign Het
Olfr524 A G 7: 140,202,231 F180L probably benign Het
Olfr810 T A 10: 129,790,890 K233M probably damaging Het
Olfr922 A G 9: 38,815,850 T116A probably benign Het
Oraov1 A G 7: 144,916,468 S45G probably damaging Het
Otof A G 5: 30,376,369 S1464P probably benign Het
Otogl A T 10: 107,777,575 Y2010N probably damaging Het
Pgap3 C T 11: 98,400,214 probably null Het
Pgbd5 T A 8: 124,374,249 K332* probably null Het
Pgs1 C T 11: 118,005,727 P410L probably damaging Het
Pkhd1l1 G A 15: 44,500,038 S618N probably benign Het
Plcb1 A T 2: 135,386,302 D1073V probably damaging Het
Pola2 T A 19: 5,951,180 T309S probably benign Het
Polg2 T A 11: 106,778,961 H161L probably damaging Het
Postn T A 3: 54,377,612 probably null Het
Ppt1 G T 4: 122,845,991 C128F probably damaging Het
Ptpn12 G A 5: 20,993,263 P678S probably damaging Het
Rcan3 A T 4: 135,412,501 probably null Het
Rgs22 T C 15: 36,101,804 N216S probably benign Het
Rgs7bp T A 13: 104,951,582 D228V probably damaging Het
Rhobtb2 A T 14: 69,796,613 S388T probably benign Het
Rnps1 C T 17: 24,420,390 R138C unknown Het
Rpl38 T C 11: 114,671,776 V36A probably benign Het
Rps7 G T 12: 28,631,753 H126Q possibly damaging Het
Sec24b G T 3: 129,991,361 Q999K possibly damaging Het
Slc19a3 A G 1: 83,019,368 V373A possibly damaging Het
Spats2l T A 1: 57,885,782 V113E probably benign Het
Ss18l1 A T 2: 180,063,345 T377S unknown Het
Surf1 A G 2: 26,915,970 F38L probably benign Het
Ticrr G A 7: 79,675,394 R556H probably damaging Het
Tmem184b A G 15: 79,365,814 S254P probably damaging Het
Tnfrsf4 G T 4: 156,016,235 R237L possibly damaging Het
Tnk2 C A 16: 32,663,742 probably benign Het
Tnks A T 8: 34,838,530 D1191E probably damaging Het
Tnr C A 1: 159,895,037 Y1017* probably null Het
Tomm34 A G 2: 164,061,006 I128T probably benign Het
Trim2 G A 3: 84,177,792 S540F possibly damaging Het
Trio A T 15: 27,732,891 I2968N probably damaging Het
Ttc24 T C 3: 88,074,874 E17G probably benign Het
Ttc41 A G 10: 86,776,214 H1117R probably benign Het
Ttn A T 2: 76,735,408 V28200D probably damaging Het
Ttn A T 2: 76,762,386 S20801T possibly damaging Het
Ube2cbp C T 9: 86,448,787 C114Y probably damaging Het
Ugt2b37 A C 5: 87,240,857 L499R probably damaging Het
Vmn1r81 T C 7: 12,260,662 I6M possibly damaging Het
Vmn2r97 A T 17: 18,929,331 Y327F probably benign Het
Vps13b T C 15: 35,709,507 S1867P probably damaging Het
Wdr11 T C 7: 129,606,607 V362A probably benign Het
Zan T A 5: 137,388,939 M4951L unknown Het
Zcwpw1 T A 5: 137,811,622 L337Q probably damaging Het
Zfp2 A T 11: 50,899,982 D411E possibly damaging Het
Zfp628 C T 7: 4,920,768 T663I probably benign Het
Zfpm1 T A 8: 122,334,924 probably null Het
Zfyve19 T C 2: 119,211,212 S87P probably benign Het
Zswim9 T A 7: 13,260,214 K672* probably null Het
Other mutations in Abcc8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01114:Abcc8 APN 7 46104664 missense probably benign
IGL01457:Abcc8 APN 7 46135493 missense possibly damaging 0.51
IGL01645:Abcc8 APN 7 46115053 missense possibly damaging 0.93
IGL01683:Abcc8 APN 7 46151667 missense possibly damaging 0.78
IGL01826:Abcc8 APN 7 46124849 missense probably benign 0.01
IGL01912:Abcc8 APN 7 46120510 missense probably damaging 1.00
IGL02218:Abcc8 APN 7 46120436 missense probably benign 0.00
IGL02326:Abcc8 APN 7 46122857 critical splice donor site probably null
IGL02403:Abcc8 APN 7 46105803 splice site probably null
IGL02411:Abcc8 APN 7 46107007 missense probably damaging 1.00
IGL02653:Abcc8 APN 7 46115767 splice site probably benign
IGL02706:Abcc8 APN 7 46166921 missense probably benign 0.08
R0295:Abcc8 UTSW 7 46118054 missense probably benign
R0381:Abcc8 UTSW 7 46108434 missense possibly damaging 0.46
R0391:Abcc8 UTSW 7 46122173 missense probably damaging 0.98
R0408:Abcc8 UTSW 7 46107033 missense probably damaging 0.99
R0496:Abcc8 UTSW 7 46108820 missense probably damaging 1.00
R1126:Abcc8 UTSW 7 46109638 missense probably damaging 0.99
R1323:Abcc8 UTSW 7 46117362 missense probably benign 0.07
R1323:Abcc8 UTSW 7 46117362 missense probably benign 0.07
R1352:Abcc8 UTSW 7 46135468 splice site probably benign
R1368:Abcc8 UTSW 7 46122860 missense probably damaging 1.00
R1437:Abcc8 UTSW 7 46179813 missense probably damaging 1.00
R1463:Abcc8 UTSW 7 46154512 missense probably benign 0.12
R1689:Abcc8 UTSW 7 46120403 missense probably benign 0.16
R1717:Abcc8 UTSW 7 46115815 missense possibly damaging 0.91
R1804:Abcc8 UTSW 7 46120479 missense probably benign 0.02
R1848:Abcc8 UTSW 7 46166902 missense probably benign
R1870:Abcc8 UTSW 7 46123915 missense probably benign 0.05
R1993:Abcc8 UTSW 7 46117423 splice site probably null
R1994:Abcc8 UTSW 7 46157119 missense probably benign 0.02
R2511:Abcc8 UTSW 7 46150780 missense probably damaging 1.00
R3840:Abcc8 UTSW 7 46108100 missense possibly damaging 0.67
R3879:Abcc8 UTSW 7 46104627 missense possibly damaging 0.90
R4444:Abcc8 UTSW 7 46136194 missense probably benign 0.09
R4463:Abcc8 UTSW 7 46106581 splice site probably null
R4761:Abcc8 UTSW 7 46113075 missense probably damaging 1.00
R4816:Abcc8 UTSW 7 46104707 missense probably benign 0.01
R4841:Abcc8 UTSW 7 46150828 missense probably damaging 1.00
R4842:Abcc8 UTSW 7 46150828 missense probably damaging 1.00
R4870:Abcc8 UTSW 7 46107259 nonsense probably null
R4969:Abcc8 UTSW 7 46105519 missense probably benign 0.02
R4975:Abcc8 UTSW 7 46150867 missense probably damaging 0.98
R5258:Abcc8 UTSW 7 46108387 missense probably benign
R5258:Abcc8 UTSW 7 46157148 missense probably benign 0.17
R5502:Abcc8 UTSW 7 46108838 missense probably benign 0.00
R5518:Abcc8 UTSW 7 46120449 missense probably benign
R5660:Abcc8 UTSW 7 46108404 missense probably benign 0.15
R5902:Abcc8 UTSW 7 46115039 missense probably benign
R5907:Abcc8 UTSW 7 46123906 missense probably benign 0.01
R6023:Abcc8 UTSW 7 46108419 missense possibly damaging 0.62
R6026:Abcc8 UTSW 7 46167000 missense probably benign
R6078:Abcc8 UTSW 7 46105844 missense probably benign 0.01
R6079:Abcc8 UTSW 7 46105844 missense probably benign 0.01
R6103:Abcc8 UTSW 7 46119021 missense possibly damaging 0.50
R6221:Abcc8 UTSW 7 46175450 missense probably benign 0.01
R6511:Abcc8 UTSW 7 46150861 missense possibly damaging 0.82
R7046:Abcc8 UTSW 7 46122940 missense probably damaging 1.00
R7230:Abcc8 UTSW 7 46117388 missense probably benign
R7287:Abcc8 UTSW 7 46113110 missense probably damaging 1.00
R7292:Abcc8 UTSW 7 46135526 missense probably benign
R7299:Abcc8 UTSW 7 46105498 missense possibly damaging 0.62
R7411:Abcc8 UTSW 7 46165917 critical splice donor site probably null
R7693:Abcc8 UTSW 7 46178544 missense probably damaging 0.99
R7704:Abcc8 UTSW 7 46106644 missense probably damaging 0.98
U15987:Abcc8 UTSW 7 46105844 missense probably benign 0.01
Z1088:Abcc8 UTSW 7 46138065 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGCTCTGCACAGATAACCAC -3'
(R):5'- TGCTGCCCTACTATGTGCTG -3'

Sequencing Primer
(F):5'- AGCATTCTCAGCACCTGC -3'
(R):5'- CCTACTATGTGCTGGCCAC -3'
Posted On2014-07-14