Incidental Mutation 'R1938:Ticrr'
ID 213688
Institutional Source Beutler Lab
Gene Symbol Ticrr
Ensembl Gene ENSMUSG00000046591
Gene Name TOPBP1-interacting checkpoint and replication regulator
Synonyms 5730590G19Rik
MMRRC Submission 039956-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.949) question?
Stock # R1938 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 79309944-79347896 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 79325142 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 556 (R556H)
Ref Sequence ENSEMBL: ENSMUSP00000145735 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035977] [ENSMUST00000206017] [ENSMUST00000206591] [ENSMUST00000206622]
AlphaFold Q8BQ33
Predicted Effect possibly damaging
Transcript: ENSMUST00000035977
AA Change: R556H

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000041377
Gene: ENSMUSG00000046591
AA Change: R556H

DomainStartEndE-ValueType
low complexity region 23 31 N/A INTRINSIC
Pfam:Treslin_N 211 1005 N/A PFAM
low complexity region 1186 1197 N/A INTRINSIC
low complexity region 1220 1235 N/A INTRINSIC
low complexity region 1339 1359 N/A INTRINSIC
low complexity region 1472 1480 N/A INTRINSIC
low complexity region 1496 1514 N/A INTRINSIC
low complexity region 1630 1643 N/A INTRINSIC
low complexity region 1694 1707 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000206017
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206072
Predicted Effect probably damaging
Transcript: ENSMUST00000206591
AA Change: R556H

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect possibly damaging
Transcript: ENSMUST00000206622
AA Change: R556H

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206677
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Treslin is involved in the initiation of DNA replication (Kumagai et al., 2010 [PubMed 20116089]).[supplied by OMIM, Apr 2010]
PHENOTYPE: Mice homozygous for an ENU-induced allele are mostly hairless, with only a light patch of hair around the face and tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 133 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 T C 7: 45,824,795 (GRCm39) K134R possibly damaging Het
Adamts17 T C 7: 66,774,820 (GRCm39) S980P probably damaging Het
Adap2 T A 11: 80,061,508 (GRCm39) I221K probably damaging Het
Adgrv1 C T 13: 81,539,876 (GRCm39) R5681Q probably damaging Het
Adipor1 T A 1: 134,350,841 (GRCm39) L30Q probably benign Het
Agpat5 A G 8: 18,928,181 (GRCm39) T249A probably benign Het
Agxt2 G T 15: 10,392,021 (GRCm39) G329V probably damaging Het
Ankrd28 A G 14: 31,427,233 (GRCm39) V801A possibly damaging Het
Ap1g2 A G 14: 55,337,229 (GRCm39) V702A possibly damaging Het
Arid3a A G 10: 79,786,540 (GRCm39) Q429R probably damaging Het
Arsb T A 13: 93,998,658 (GRCm39) L322Q probably damaging Het
Ash1l A G 3: 88,891,729 (GRCm39) T1203A probably damaging Het
Atad2 T A 15: 57,960,101 (GRCm39) N1308Y possibly damaging Het
Atp10b A T 11: 43,121,245 (GRCm39) R969S probably benign Het
Bmp10 T C 6: 87,410,702 (GRCm39) I165T possibly damaging Het
Ccdc121rt2 C A 5: 112,597,667 (GRCm39) C71* probably null Het
Ccne1 A G 7: 37,805,702 (GRCm39) probably null Het
Cenpe A G 3: 134,953,240 (GRCm39) N1565D probably damaging Het
Chd1 A T 17: 15,982,748 (GRCm39) E1404D probably benign Het
Chd7 G A 4: 8,847,200 (GRCm39) E1648K probably damaging Het
Chodl T C 16: 78,738,314 (GRCm39) I94T possibly damaging Het
Chsy3 T C 18: 59,542,584 (GRCm39) F574S probably damaging Het
Clpb A T 7: 101,412,863 (GRCm39) I317F probably damaging Het
Cnga3 T A 1: 37,300,954 (GRCm39) V558D possibly damaging Het
Col9a1 C T 1: 24,261,554 (GRCm39) P573S probably damaging Het
Crat A T 2: 30,303,073 (GRCm39) D71E probably benign Het
Cspg4 A G 9: 56,794,385 (GRCm39) T707A probably benign Het
Ctsr T A 13: 61,310,259 (GRCm39) R132S probably benign Het
Ctu2 T C 8: 123,206,024 (GRCm39) L255P probably damaging Het
Cyp2c69 T C 19: 39,837,810 (GRCm39) Y424C probably damaging Het
Ddx27 A T 2: 166,876,029 (GRCm39) K726N probably damaging Het
Dennd4a A G 9: 64,749,772 (GRCm39) Q121R probably damaging Het
Dis3 A G 14: 99,335,026 (GRCm39) F192S probably benign Het
Ect2l C T 10: 18,020,383 (GRCm39) S487N probably benign Het
Eml1 T A 12: 108,487,655 (GRCm39) F524L possibly damaging Het
Espl1 T C 15: 102,213,477 (GRCm39) I601T probably benign Het
Fbxo40 C A 16: 36,789,713 (GRCm39) V466L probably damaging Het
Frmpd1 C T 4: 45,283,711 (GRCm39) T844M probably damaging Het
Frs2 T A 10: 116,917,011 (GRCm39) probably benign Het
Fuom G T 7: 139,679,521 (GRCm39) T133K probably benign Het
Garnl3 T A 2: 32,895,212 (GRCm39) H619L probably damaging Het
Gm4861 G T 3: 137,257,876 (GRCm39) N36K unknown Het
Gps2 G T 11: 69,806,195 (GRCm39) M153I probably benign Het
Gtf2ird1 A G 5: 134,444,099 (GRCm39) V52A probably damaging Het
Gtpbp8 A T 16: 44,565,785 (GRCm39) D137E probably benign Het
Haus4 A G 14: 54,781,733 (GRCm39) C213R probably damaging Het
Hdc T A 2: 126,448,317 (GRCm39) H142L possibly damaging Het
Hephl1 T C 9: 14,965,283 (GRCm39) D1069G possibly damaging Het
Herc6 T A 6: 57,602,926 (GRCm39) V535D probably damaging Het
Hipk3 A T 2: 104,260,533 (GRCm39) H1082Q possibly damaging Het
Hps5 A T 7: 46,422,691 (GRCm39) V513D probably damaging Het
Ifna13 T A 4: 88,562,412 (GRCm39) I71F probably damaging Het
Il1rl2 T C 1: 40,402,484 (GRCm39) I426T probably damaging Het
Irf5 A T 6: 29,536,738 (GRCm39) D483V probably benign Het
Jakmip3 A G 7: 138,621,867 (GRCm39) R256G probably damaging Het
Jazf1 T C 6: 52,754,600 (GRCm39) I159V probably damaging Het
Kmo A G 1: 175,479,154 (GRCm39) D230G possibly damaging Het
Lrrc74b A G 16: 17,371,058 (GRCm39) V213A probably benign Het
LTO1 A G 7: 144,470,205 (GRCm39) S45G probably damaging Het
Ly6g5b T C 17: 35,333,704 (GRCm39) D36G possibly damaging Het
Mab21l4 T C 1: 93,079,730 (GRCm39) *453W probably null Het
Macc1 T G 12: 119,409,466 (GRCm39) L78R probably damaging Het
Mettl4 A T 17: 95,055,285 (GRCm39) D51E possibly damaging Het
Mfap1a G A 2: 121,332,835 (GRCm39) L199F possibly damaging Het
Mmp17 G T 5: 129,679,190 (GRCm39) R363L probably damaging Het
Mrc1 G A 2: 14,324,052 (GRCm39) A1130T possibly damaging Het
Mrpl15 C T 1: 4,847,805 (GRCm39) A165T probably damaging Het
Mrpl45 G A 11: 97,206,770 (GRCm39) probably null Het
Ms4a3 C T 19: 11,613,204 (GRCm39) A85T possibly damaging Het
Mttp A T 3: 137,830,882 (GRCm39) D77E probably benign Het
Muc6 A G 7: 141,217,011 (GRCm39) L2489P probably damaging Het
Myl3 G A 9: 110,595,802 (GRCm39) E100K probably damaging Het
Nbea T A 3: 55,992,743 (GRCm39) N288Y probably damaging Het
Ncoa7 A G 10: 30,574,166 (GRCm39) V181A probably benign Het
Oat C T 7: 132,159,934 (GRCm39) V429M probably benign Het
Or2ak6 A T 11: 58,593,449 (GRCm39) *307C probably null Het
Or4x6 T G 2: 89,949,427 (GRCm39) I172L probably damaging Het
Or5d36 A T 2: 87,901,300 (GRCm39) L142Q probably damaging Het
Or5p80 T C 7: 108,230,045 (GRCm39) I282T probably benign Het
Or5w19 G A 2: 87,698,805 (GRCm39) V157I probably benign Het
Or6b13 A G 7: 139,782,144 (GRCm39) F180L probably benign Het
Or6c69b T A 10: 129,626,759 (GRCm39) K233M probably damaging Het
Or8b55 A G 9: 38,727,146 (GRCm39) T116A probably benign Het
Or8s16 T A 15: 98,211,261 (GRCm39) M57L probably damaging Het
Otof A G 5: 30,533,713 (GRCm39) S1464P probably benign Het
Otogl A T 10: 107,613,436 (GRCm39) Y2010N probably damaging Het
Pgap3 C T 11: 98,291,040 (GRCm39) probably null Het
Pgbd5 T A 8: 125,100,988 (GRCm39) K332* probably null Het
Pgs1 C T 11: 117,896,553 (GRCm39) P410L probably damaging Het
Pkhd1l1 G A 15: 44,363,434 (GRCm39) S618N probably benign Het
Plcb1 A T 2: 135,228,222 (GRCm39) D1073V probably damaging Het
Pola2 T A 19: 6,001,208 (GRCm39) T309S probably benign Het
Polg2 T A 11: 106,669,787 (GRCm39) H161L probably damaging Het
Postn T A 3: 54,285,033 (GRCm39) probably null Het
Ppt1 G T 4: 122,739,784 (GRCm39) C128F probably damaging Het
Ptpn12 G A 5: 21,198,261 (GRCm39) P678S probably damaging Het
Rcan3 A T 4: 135,139,812 (GRCm39) probably null Het
Rgs22 T C 15: 36,101,950 (GRCm39) N216S probably benign Het
Rgs7bp T A 13: 105,088,090 (GRCm39) D228V probably damaging Het
Rhobtb2 A T 14: 70,034,062 (GRCm39) S388T probably benign Het
Rnps1 C T 17: 24,639,364 (GRCm39) R138C unknown Het
Rpl38 T C 11: 114,562,602 (GRCm39) V36A probably benign Het
Rps7 G T 12: 28,681,752 (GRCm39) H126Q possibly damaging Het
Sec24b G T 3: 129,785,010 (GRCm39) Q999K possibly damaging Het
Slc19a3 A G 1: 82,997,089 (GRCm39) V373A possibly damaging Het
Spats2l T A 1: 57,924,941 (GRCm39) V113E probably benign Het
Ss18l1 A T 2: 179,705,138 (GRCm39) T377S unknown Het
Surf1 A G 2: 26,805,982 (GRCm39) F38L probably benign Het
Tmem184b A G 15: 79,250,014 (GRCm39) S254P probably damaging Het
Tnfrsf4 G T 4: 156,100,692 (GRCm39) R237L possibly damaging Het
Tnk2 C A 16: 32,482,560 (GRCm39) probably benign Het
Tnks A T 8: 35,305,684 (GRCm39) D1191E probably damaging Het
Tnr C A 1: 159,722,607 (GRCm39) Y1017* probably null Het
Tomm34 A G 2: 163,902,926 (GRCm39) I128T probably benign Het
Trim2 G A 3: 84,085,099 (GRCm39) S540F possibly damaging Het
Trio A T 15: 27,732,977 (GRCm39) I2968N probably damaging Het
Ttc24 T C 3: 87,982,181 (GRCm39) E17G probably benign Het
Ttc41 A G 10: 86,612,078 (GRCm39) H1117R probably benign Het
Ttn A T 2: 76,565,752 (GRCm39) V28200D probably damaging Het
Ttn A T 2: 76,592,730 (GRCm39) S20801T possibly damaging Het
Ube3d C T 9: 86,330,840 (GRCm39) C114Y probably damaging Het
Ugt2b37 A C 5: 87,388,716 (GRCm39) L499R probably damaging Het
Vmn1r81 T C 7: 11,994,589 (GRCm39) I6M possibly damaging Het
Vmn2r97 A T 17: 19,149,593 (GRCm39) Y327F probably benign Het
Vps13b T C 15: 35,709,653 (GRCm39) S1867P probably damaging Het
Wdr11 T C 7: 129,208,331 (GRCm39) V362A probably benign Het
Zan T A 5: 137,387,201 (GRCm39) M4951L unknown Het
Zcwpw1 T A 5: 137,809,884 (GRCm39) L337Q probably damaging Het
Zfp2 A T 11: 50,790,809 (GRCm39) D411E possibly damaging Het
Zfp628 C T 7: 4,923,767 (GRCm39) T663I probably benign Het
Zfpm1 T A 8: 123,061,663 (GRCm39) probably null Het
Zfyve19 T C 2: 119,041,693 (GRCm39) S87P probably benign Het
Zswim9 T A 7: 12,994,141 (GRCm39) K672* probably null Het
Other mutations in Ticrr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Ticrr APN 7 79,327,031 (GRCm39) missense probably damaging 1.00
IGL00596:Ticrr APN 7 79,327,041 (GRCm39) missense probably damaging 1.00
IGL01327:Ticrr APN 7 79,344,209 (GRCm39) missense probably benign 0.00
IGL01525:Ticrr APN 7 79,332,197 (GRCm39) missense probably damaging 1.00
IGL01565:Ticrr APN 7 79,344,296 (GRCm39) missense probably benign
IGL01936:Ticrr APN 7 79,344,297 (GRCm39) missense probably benign 0.11
IGL02160:Ticrr APN 7 79,343,767 (GRCm39) missense probably benign 0.29
IGL02246:Ticrr APN 7 79,325,076 (GRCm39) missense probably damaging 1.00
IGL02487:Ticrr APN 7 79,332,769 (GRCm39) missense possibly damaging 0.86
IGL02593:Ticrr APN 7 79,345,214 (GRCm39) missense probably damaging 0.99
IGL02970:Ticrr APN 7 79,344,919 (GRCm39) missense probably benign 0.01
FR4304:Ticrr UTSW 7 79,344,059 (GRCm39) intron probably benign
PIT4305001:Ticrr UTSW 7 79,328,771 (GRCm39) missense possibly damaging 0.95
PIT4791001:Ticrr UTSW 7 79,319,386 (GRCm39) missense possibly damaging 0.92
R0016:Ticrr UTSW 7 79,343,540 (GRCm39) missense probably benign 0.01
R0062:Ticrr UTSW 7 79,317,654 (GRCm39) missense probably benign 0.01
R0062:Ticrr UTSW 7 79,317,654 (GRCm39) missense probably benign 0.01
R0067:Ticrr UTSW 7 79,327,158 (GRCm39) missense probably damaging 1.00
R0067:Ticrr UTSW 7 79,327,158 (GRCm39) missense probably damaging 1.00
R0362:Ticrr UTSW 7 79,327,088 (GRCm39) missense probably damaging 1.00
R0482:Ticrr UTSW 7 79,344,236 (GRCm39) missense probably damaging 0.99
R0595:Ticrr UTSW 7 79,345,311 (GRCm39) missense possibly damaging 0.94
R1118:Ticrr UTSW 7 79,343,701 (GRCm39) missense probably benign 0.23
R1119:Ticrr UTSW 7 79,343,701 (GRCm39) missense probably benign 0.23
R1572:Ticrr UTSW 7 79,331,572 (GRCm39) missense probably damaging 1.00
R1658:Ticrr UTSW 7 79,345,297 (GRCm39) missense possibly damaging 0.57
R1757:Ticrr UTSW 7 79,328,794 (GRCm39) nonsense probably null
R1757:Ticrr UTSW 7 79,325,071 (GRCm39) missense probably damaging 0.99
R1862:Ticrr UTSW 7 79,344,955 (GRCm39) missense probably damaging 1.00
R1869:Ticrr UTSW 7 79,328,883 (GRCm39) missense probably damaging 1.00
R1966:Ticrr UTSW 7 79,344,483 (GRCm39) nonsense probably null
R2006:Ticrr UTSW 7 79,343,821 (GRCm39) missense possibly damaging 0.93
R2178:Ticrr UTSW 7 79,315,433 (GRCm39) missense probably benign 0.12
R3404:Ticrr UTSW 7 79,344,539 (GRCm39) missense probably benign 0.06
R3405:Ticrr UTSW 7 79,344,539 (GRCm39) missense probably benign 0.06
R3941:Ticrr UTSW 7 79,343,445 (GRCm39) intron probably benign
R3950:Ticrr UTSW 7 79,331,817 (GRCm39) missense probably damaging 1.00
R3951:Ticrr UTSW 7 79,331,817 (GRCm39) missense probably damaging 1.00
R3952:Ticrr UTSW 7 79,331,817 (GRCm39) missense probably damaging 1.00
R4967:Ticrr UTSW 7 79,310,158 (GRCm39) missense probably damaging 0.99
R4972:Ticrr UTSW 7 79,319,416 (GRCm39) missense probably damaging 0.98
R5259:Ticrr UTSW 7 79,344,471 (GRCm39) missense probably benign 0.01
R5272:Ticrr UTSW 7 79,319,353 (GRCm39) missense probably benign 0.44
R5374:Ticrr UTSW 7 79,340,690 (GRCm39) nonsense probably null
R5480:Ticrr UTSW 7 79,310,557 (GRCm39) missense probably damaging 1.00
R5568:Ticrr UTSW 7 79,345,044 (GRCm39) nonsense probably null
R5568:Ticrr UTSW 7 79,339,715 (GRCm39) critical splice donor site probably null
R5588:Ticrr UTSW 7 79,328,853 (GRCm39) missense probably damaging 1.00
R5698:Ticrr UTSW 7 79,328,881 (GRCm39) missense probably benign
R5879:Ticrr UTSW 7 79,346,438 (GRCm39) missense probably benign 0.12
R5980:Ticrr UTSW 7 79,310,703 (GRCm39) missense probably damaging 0.99
R6128:Ticrr UTSW 7 79,343,716 (GRCm39) missense probably damaging 1.00
R6277:Ticrr UTSW 7 79,344,444 (GRCm39) missense probably benign 0.00
R6335:Ticrr UTSW 7 79,344,031 (GRCm39) splice site probably null
R6866:Ticrr UTSW 7 79,343,705 (GRCm39) missense possibly damaging 0.47
R6905:Ticrr UTSW 7 79,315,598 (GRCm39) missense probably benign 0.00
R6923:Ticrr UTSW 7 79,341,601 (GRCm39) missense probably damaging 0.98
R6962:Ticrr UTSW 7 79,315,645 (GRCm39) missense possibly damaging 0.84
R7232:Ticrr UTSW 7 79,343,490 (GRCm39) missense probably damaging 0.96
R7285:Ticrr UTSW 7 79,310,610 (GRCm39) missense possibly damaging 0.93
R7385:Ticrr UTSW 7 79,341,597 (GRCm39) missense possibly damaging 0.93
R7426:Ticrr UTSW 7 79,343,734 (GRCm39) missense probably benign
R7583:Ticrr UTSW 7 79,346,487 (GRCm39) nonsense probably null
R7749:Ticrr UTSW 7 79,328,844 (GRCm39) missense possibly damaging 0.94
R7863:Ticrr UTSW 7 79,331,760 (GRCm39) missense possibly damaging 0.92
R7899:Ticrr UTSW 7 79,319,233 (GRCm39) missense probably benign 0.23
R7935:Ticrr UTSW 7 79,331,584 (GRCm39) missense probably damaging 0.99
R8005:Ticrr UTSW 7 79,343,796 (GRCm39) missense probably damaging 0.98
R8080:Ticrr UTSW 7 79,334,012 (GRCm39) splice site probably null
R8181:Ticrr UTSW 7 79,310,728 (GRCm39) missense possibly damaging 0.92
R8349:Ticrr UTSW 7 79,344,428 (GRCm39) missense probably benign 0.27
R8410:Ticrr UTSW 7 79,317,423 (GRCm39) missense probably damaging 0.98
R8449:Ticrr UTSW 7 79,344,428 (GRCm39) missense probably benign 0.27
R9073:Ticrr UTSW 7 79,317,679 (GRCm39) missense probably benign 0.01
R9090:Ticrr UTSW 7 79,310,604 (GRCm39) missense possibly damaging 0.85
R9271:Ticrr UTSW 7 79,310,604 (GRCm39) missense possibly damaging 0.85
R9287:Ticrr UTSW 7 79,343,516 (GRCm39) missense possibly damaging 0.89
R9368:Ticrr UTSW 7 79,330,735 (GRCm39) missense probably damaging 0.99
R9469:Ticrr UTSW 7 79,344,511 (GRCm39) missense probably benign 0.03
R9502:Ticrr UTSW 7 79,343,597 (GRCm39) missense probably benign
R9614:Ticrr UTSW 7 79,345,754 (GRCm39) missense probably damaging 1.00
R9761:Ticrr UTSW 7 79,345,313 (GRCm39) missense probably damaging 1.00
R9779:Ticrr UTSW 7 79,328,802 (GRCm39) missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- CACGTGTTCTGATTCTCATGGT -3'
(R):5'- GTTTCCATTTCAATCTTAATCAAGCT -3'

Sequencing Primer
(F):5'- TTTGCAGAGTTAGAATTTGGCC -3'
(R):5'- GGTGCATGACTTTAATCCTGGCAC -3'
Posted On 2014-07-14