Incidental Mutation 'R1938:Tnks'
ID213699
Institutional Source Beutler Lab
Gene Symbol Tnks
Ensembl Gene ENSMUSG00000031529
Gene Nametankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase
SynonymsmTNKS1, 4930554K12Rik, D130072O21Rik, TANK1, tankyrase 1
MMRRC Submission 039956-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1938 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location34826460-34965690 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 34838530 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1191 (D1191E)
Ref Sequence ENSEMBL: ENSMUSP00000033929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033929]
PDB Structure
Crystal structure of a mouse Tankyrase-Axin complex [X-RAY DIFFRACTION]
Co-crystal structure of tankyrase 1 with compound 3 [(4S)-3-{4-[6-amino-5-(pyrimidin-2-yl)pyridin-3-yl]phenyl}-5,5-dimethyl-4-phenyl-1,3-oxazolidin-2-one] [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000033929
AA Change: D1191E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033929
Gene: ENSMUSG00000031529
AA Change: D1191E

DomainStartEndE-ValueType
low complexity region 8 17 N/A INTRINSIC
low complexity region 20 55 N/A INTRINSIC
low complexity region 68 86 N/A INTRINSIC
low complexity region 91 175 N/A INTRINSIC
ANK 208 237 4.26e-4 SMART
ANK 241 270 3.23e-4 SMART
ANK 274 303 3.28e-5 SMART
ANK 327 355 2.66e3 SMART
ANK 361 390 7.64e-6 SMART
ANK 394 423 2.62e-4 SMART
ANK 427 456 1.99e-4 SMART
ANK 514 546 3.18e-3 SMART
ANK 550 579 1.51e-4 SMART
ANK 583 612 4.26e-4 SMART
ANK 642 670 2.21e3 SMART
ANK 676 705 4.03e-5 SMART
ANK 709 738 2.48e-5 SMART
ANK 742 771 1.64e-5 SMART
low complexity region 792 810 N/A INTRINSIC
ANK 829 858 1.47e-7 SMART
ANK 862 891 2.21e-2 SMART
ANK 895 924 3.13e-2 SMART
low complexity region 996 1010 N/A INTRINSIC
SAM 1017 1082 1.14e-12 SMART
Pfam:PARP 1098 1303 1.5e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209632
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209904
Predicted Effect unknown
Transcript: ENSMUST00000210014
AA Change: D47E
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210870
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele fail to exhibit any abonormalities. Male mice homozygous for a gene trapped allele exhibit decreased fat pad weight, increased metabolism, hyperinsulinemia, and hypoglycemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 133 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik T C 1: 93,152,008 *453W probably null Het
Abcc8 T C 7: 46,175,371 K134R possibly damaging Het
Adamts17 T C 7: 67,125,072 S980P probably damaging Het
Adap2 T A 11: 80,170,682 I221K probably damaging Het
Adgrv1 C T 13: 81,391,757 R5681Q probably damaging Het
Adipor1 T A 1: 134,423,103 L30Q probably benign Het
Agpat5 A G 8: 18,878,165 T249A probably benign Het
Agxt2 G T 15: 10,391,935 G329V probably damaging Het
Ankrd28 A G 14: 31,705,276 V801A possibly damaging Het
Ap1g2 A G 14: 55,099,772 V702A possibly damaging Het
Arid3a A G 10: 79,950,706 Q429R probably damaging Het
Arsb T A 13: 93,862,150 L322Q probably damaging Het
Ash1l A G 3: 88,984,422 T1203A probably damaging Het
Atad2 T A 15: 58,096,705 N1308Y possibly damaging Het
Atp10b A T 11: 43,230,418 R969S probably benign Het
Bmp10 T C 6: 87,433,720 I165T possibly damaging Het
Ccne1 A G 7: 38,106,277 probably null Het
Cenpe A G 3: 135,247,479 N1565D probably damaging Het
Chd1 A T 17: 15,762,486 E1404D probably benign Het
Chd7 G A 4: 8,847,200 E1648K probably damaging Het
Chodl T C 16: 78,941,426 I94T possibly damaging Het
Chsy3 T C 18: 59,409,512 F574S probably damaging Het
Clpb A T 7: 101,763,656 I317F probably damaging Het
Cnga3 T A 1: 37,261,873 V558D possibly damaging Het
Col9a1 C T 1: 24,222,473 P573S probably damaging Het
Crat A T 2: 30,413,061 D71E probably benign Het
Cspg4 A G 9: 56,887,101 T707A probably benign Het
Ctsr T A 13: 61,162,445 R132S probably benign Het
Ctu2 T C 8: 122,479,285 L255P probably damaging Het
Cyp2c69 T C 19: 39,849,366 Y424C probably damaging Het
Ddx27 A T 2: 167,034,109 K726N probably damaging Het
Dennd4a A G 9: 64,842,490 Q121R probably damaging Het
Dis3 A G 14: 99,097,590 F192S probably benign Het
Ect2l C T 10: 18,144,635 S487N probably benign Het
Eml1 T A 12: 108,521,396 F524L possibly damaging Het
Espl1 T C 15: 102,305,042 I601T probably benign Het
Fbxo40 C A 16: 36,969,351 V466L probably damaging Het
Frmpd1 C T 4: 45,283,711 T844M probably damaging Het
Frs2 T A 10: 117,081,106 probably benign Het
Fuom G T 7: 140,099,608 T133K probably benign Het
Garnl3 T A 2: 33,005,200 H619L probably damaging Het
Gm4861 G T 3: 137,552,115 N36K unknown Het
Gm6588 C A 5: 112,449,801 C71* probably null Het
Gps2 G T 11: 69,915,369 M153I probably benign Het
Gtf2ird1 A G 5: 134,415,245 V52A probably damaging Het
Gtpbp8 A T 16: 44,745,422 D137E probably benign Het
Haus4 A G 14: 54,544,276 C213R probably damaging Het
Hdc T A 2: 126,606,397 H142L possibly damaging Het
Hephl1 T C 9: 15,053,987 D1069G possibly damaging Het
Herc6 T A 6: 57,625,941 V535D probably damaging Het
Hipk3 A T 2: 104,430,188 H1082Q possibly damaging Het
Hps5 A T 7: 46,773,267 V513D probably damaging Het
Ifna13 T A 4: 88,644,175 I71F probably damaging Het
Il1rl2 T C 1: 40,363,324 I426T probably damaging Het
Irf5 A T 6: 29,536,739 D483V probably benign Het
Jakmip3 A G 7: 139,020,138 R256G probably damaging Het
Jazf1 T C 6: 52,777,615 I159V probably damaging Het
Kmo A G 1: 175,651,588 D230G possibly damaging Het
Lrrc74b A G 16: 17,553,194 V213A probably benign Het
Ly6g5b T C 17: 35,114,728 D36G possibly damaging Het
Macc1 T G 12: 119,445,731 L78R probably damaging Het
Mettl4 A T 17: 94,747,857 D51E possibly damaging Het
Mfap1a G A 2: 121,502,354 L199F possibly damaging Het
Mmp17 G T 5: 129,602,126 R363L probably damaging Het
Mrc1 G A 2: 14,319,241 A1130T possibly damaging Het
Mrpl15 C T 1: 4,777,582 A165T probably damaging Het
Mrpl45 G A 11: 97,315,944 probably null Het
Ms4a3 C T 19: 11,635,840 A85T possibly damaging Het
Mttp A T 3: 138,125,121 D77E probably benign Het
Muc6 A G 7: 141,637,098 L2489P probably damaging Het
Myl3 G A 9: 110,766,734 E100K probably damaging Het
Nbea T A 3: 56,085,322 N288Y probably damaging Het
Ncoa7 A G 10: 30,698,170 V181A probably benign Het
Oat C T 7: 132,558,205 V429M probably benign Het
Olfr1152 G A 2: 87,868,461 V157I probably benign Het
Olfr1163 A T 2: 88,070,956 L142Q probably damaging Het
Olfr1269 T G 2: 90,119,083 I172L probably damaging Het
Olfr285 T A 15: 98,313,380 M57L probably damaging Het
Olfr319 A T 11: 58,702,623 *307C probably null Het
Olfr508 T C 7: 108,630,838 I282T probably benign Het
Olfr524 A G 7: 140,202,231 F180L probably benign Het
Olfr810 T A 10: 129,790,890 K233M probably damaging Het
Olfr922 A G 9: 38,815,850 T116A probably benign Het
Oraov1 A G 7: 144,916,468 S45G probably damaging Het
Otof A G 5: 30,376,369 S1464P probably benign Het
Otogl A T 10: 107,777,575 Y2010N probably damaging Het
Pgap3 C T 11: 98,400,214 probably null Het
Pgbd5 T A 8: 124,374,249 K332* probably null Het
Pgs1 C T 11: 118,005,727 P410L probably damaging Het
Pkhd1l1 G A 15: 44,500,038 S618N probably benign Het
Plcb1 A T 2: 135,386,302 D1073V probably damaging Het
Pola2 T A 19: 5,951,180 T309S probably benign Het
Polg2 T A 11: 106,778,961 H161L probably damaging Het
Postn T A 3: 54,377,612 probably null Het
Ppt1 G T 4: 122,845,991 C128F probably damaging Het
Ptpn12 G A 5: 20,993,263 P678S probably damaging Het
Rcan3 A T 4: 135,412,501 probably null Het
Rgs22 T C 15: 36,101,804 N216S probably benign Het
Rgs7bp T A 13: 104,951,582 D228V probably damaging Het
Rhobtb2 A T 14: 69,796,613 S388T probably benign Het
Rnps1 C T 17: 24,420,390 R138C unknown Het
Rpl38 T C 11: 114,671,776 V36A probably benign Het
Rps7 G T 12: 28,631,753 H126Q possibly damaging Het
Sec24b G T 3: 129,991,361 Q999K possibly damaging Het
Slc19a3 A G 1: 83,019,368 V373A possibly damaging Het
Spats2l T A 1: 57,885,782 V113E probably benign Het
Ss18l1 A T 2: 180,063,345 T377S unknown Het
Surf1 A G 2: 26,915,970 F38L probably benign Het
Ticrr G A 7: 79,675,394 R556H probably damaging Het
Tmem184b A G 15: 79,365,814 S254P probably damaging Het
Tnfrsf4 G T 4: 156,016,235 R237L possibly damaging Het
Tnk2 C A 16: 32,663,742 probably benign Het
Tnr C A 1: 159,895,037 Y1017* probably null Het
Tomm34 A G 2: 164,061,006 I128T probably benign Het
Trim2 G A 3: 84,177,792 S540F possibly damaging Het
Trio A T 15: 27,732,891 I2968N probably damaging Het
Ttc24 T C 3: 88,074,874 E17G probably benign Het
Ttc41 A G 10: 86,776,214 H1117R probably benign Het
Ttn A T 2: 76,735,408 V28200D probably damaging Het
Ttn A T 2: 76,762,386 S20801T possibly damaging Het
Ube2cbp C T 9: 86,448,787 C114Y probably damaging Het
Ugt2b37 A C 5: 87,240,857 L499R probably damaging Het
Vmn1r81 T C 7: 12,260,662 I6M possibly damaging Het
Vmn2r97 A T 17: 18,929,331 Y327F probably benign Het
Vps13b T C 15: 35,709,507 S1867P probably damaging Het
Wdr11 T C 7: 129,606,607 V362A probably benign Het
Zan T A 5: 137,388,939 M4951L unknown Het
Zcwpw1 T A 5: 137,811,622 L337Q probably damaging Het
Zfp2 A T 11: 50,899,982 D411E possibly damaging Het
Zfp628 C T 7: 4,920,768 T663I probably benign Het
Zfpm1 T A 8: 122,334,924 probably null Het
Zfyve19 T C 2: 119,211,212 S87P probably benign Het
Zswim9 T A 7: 13,260,214 K672* probably null Het
Other mutations in Tnks
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Tnks APN 8 34861689 splice site probably benign
IGL00901:Tnks APN 8 34838395 nonsense probably null
IGL01448:Tnks APN 8 34839982 missense probably damaging 1.00
IGL01455:Tnks APN 8 34940900 missense probably damaging 0.99
IGL01962:Tnks APN 8 34869524 missense probably damaging 1.00
IGL02088:Tnks APN 8 34839994 missense possibly damaging 0.50
IGL02260:Tnks APN 8 34842983 missense probably damaging 0.99
IGL02454:Tnks APN 8 34831728 unclassified probably benign
IGL02486:Tnks APN 8 34851198 missense probably damaging 1.00
IGL02612:Tnks APN 8 34849299 missense possibly damaging 0.48
IGL03179:Tnks APN 8 34848670 missense probably benign 0.38
IGL03404:Tnks APN 8 34940704 missense probably damaging 1.00
R0256:Tnks UTSW 8 34861547 missense probably benign 0.07
R0265:Tnks UTSW 8 34839970 nonsense probably null
R0334:Tnks UTSW 8 34853259 nonsense probably null
R0414:Tnks UTSW 8 34853309 missense probably damaging 1.00
R0526:Tnks UTSW 8 34853303 missense probably benign 0.23
R0622:Tnks UTSW 8 34940822 missense probably damaging 1.00
R1445:Tnks UTSW 8 34834603 splice site probably benign
R1618:Tnks UTSW 8 34875276 missense probably damaging 1.00
R1779:Tnks UTSW 8 34857518 missense probably benign 0.18
R1919:Tnks UTSW 8 34875232 missense probably damaging 1.00
R2018:Tnks UTSW 8 34851106 missense probably damaging 1.00
R2198:Tnks UTSW 8 34848649 missense probably benign
R2198:Tnks UTSW 8 34873067 missense probably benign 0.29
R2925:Tnks UTSW 8 34965661 missense unknown
R3828:Tnks UTSW 8 34873178 missense probably damaging 1.00
R3913:Tnks UTSW 8 34873074 missense probably damaging 0.99
R3916:Tnks UTSW 8 34853361 missense probably damaging 1.00
R3917:Tnks UTSW 8 34853361 missense probably damaging 1.00
R3930:Tnks UTSW 8 34940812 missense probably damaging 1.00
R4659:Tnks UTSW 8 34849311 missense possibly damaging 0.53
R4760:Tnks UTSW 8 34851783 missense probably benign 0.38
R5091:Tnks UTSW 8 34841809 missense probably benign 0.40
R5419:Tnks UTSW 8 34965566 missense unknown
R5558:Tnks UTSW 8 34965665 start codon destroyed probably null
R5582:Tnks UTSW 8 34940861 missense probably benign 0.14
R6035:Tnks UTSW 8 34918461 missense possibly damaging 0.93
R6035:Tnks UTSW 8 34918461 missense possibly damaging 0.93
R6495:Tnks UTSW 8 34839966 critical splice donor site probably null
R6527:Tnks UTSW 8 34873093 missense probably benign 0.36
R6991:Tnks UTSW 8 34834493 missense probably damaging 1.00
R7015:Tnks UTSW 8 34838547 missense probably benign 0.04
R7038:Tnks UTSW 8 34851636 missense probably damaging 0.99
R7057:Tnks UTSW 8 34840014 missense probably damaging 1.00
R7167:Tnks UTSW 8 34849304 missense probably damaging 0.98
R7250:Tnks UTSW 8 34851758 missense probably damaging 0.98
R7475:Tnks UTSW 8 34831712 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGACAACCATTGCAGTCAAGG -3'
(R):5'- CTTCCCAAAACCTGTGCCATG -3'

Sequencing Primer
(F):5'- CCATTGCAGTCAAGGCAGGAC -3'
(R):5'- GTCTGAATTTGCTGCTAAACTCCAG -3'
Posted On2014-07-14