Incidental Mutation 'R1938:Trio'
ID213744
Institutional Source Beutler Lab
Gene Symbol Trio
Ensembl Gene ENSMUSG00000022263
Gene Nametriple functional domain (PTPRF interacting)
SynonymsSolo, 6720464I07Rik
MMRRC Submission 039956-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1938 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location27730651-28025848 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 27732891 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 2968 (I2968N)
Ref Sequence ENSEMBL: ENSMUSP00000087714 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090247]
Predicted Effect probably damaging
Transcript: ENSMUST00000090247
AA Change: I2968N

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000087714
Gene: ENSMUSG00000022263
AA Change: I2968N

DomainStartEndE-ValueType
low complexity region 2 40 N/A INTRINSIC
SEC14 68 207 3.4e-26 SMART
SPEC 221 337 2.48e-9 SMART
SPEC 343 445 1.92e-15 SMART
SPEC 569 671 5.35e-14 SMART
SPEC 674 783 1.18e-6 SMART
SPEC 910 1011 2.6e-12 SMART
SPEC 1141 1243 7e-18 SMART
low complexity region 1249 1258 N/A INTRINSIC
RhoGEF 1296 1466 2.79e-53 SMART
PH 1480 1593 1.53e-9 SMART
SH3 1659 1720 1.9e-8 SMART
low complexity region 1788 1802 N/A INTRINSIC
low complexity region 1837 1863 N/A INTRINSIC
low complexity region 1936 1954 N/A INTRINSIC
RhoGEF 1973 2144 1.32e-63 SMART
PH 2158 2273 3.6e-6 SMART
low complexity region 2291 2341 N/A INTRINSIC
low complexity region 2371 2390 N/A INTRINSIC
low complexity region 2491 2503 N/A INTRINSIC
SH3 2558 2619 1.04e0 SMART
low complexity region 2640 2660 N/A INTRINSIC
IGc2 2701 2770 4e-12 SMART
S_TKc 2800 3054 4.84e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000226713
Predicted Effect probably benign
Transcript: ENSMUST00000227030
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227999
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228054
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large protein that functions as a GDP to GTP exchange factor. This protein promotes the reorganization of the actin cytoskeleton, thereby playing a role in cell migration and growth. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous mutant mice die during late embryonic development or shortly after birth. They exhibit abnormal skeletal myogenesis and display aberrant organization within the hippocampus and olfactory bulb. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 133 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik T C 1: 93,152,008 *453W probably null Het
Abcc8 T C 7: 46,175,371 K134R possibly damaging Het
Adamts17 T C 7: 67,125,072 S980P probably damaging Het
Adap2 T A 11: 80,170,682 I221K probably damaging Het
Adgrv1 C T 13: 81,391,757 R5681Q probably damaging Het
Adipor1 T A 1: 134,423,103 L30Q probably benign Het
Agpat5 A G 8: 18,878,165 T249A probably benign Het
Agxt2 G T 15: 10,391,935 G329V probably damaging Het
Ankrd28 A G 14: 31,705,276 V801A possibly damaging Het
Ap1g2 A G 14: 55,099,772 V702A possibly damaging Het
Arid3a A G 10: 79,950,706 Q429R probably damaging Het
Arsb T A 13: 93,862,150 L322Q probably damaging Het
Ash1l A G 3: 88,984,422 T1203A probably damaging Het
Atad2 T A 15: 58,096,705 N1308Y possibly damaging Het
Atp10b A T 11: 43,230,418 R969S probably benign Het
Bmp10 T C 6: 87,433,720 I165T possibly damaging Het
Ccne1 A G 7: 38,106,277 probably null Het
Cenpe A G 3: 135,247,479 N1565D probably damaging Het
Chd1 A T 17: 15,762,486 E1404D probably benign Het
Chd7 G A 4: 8,847,200 E1648K probably damaging Het
Chodl T C 16: 78,941,426 I94T possibly damaging Het
Chsy3 T C 18: 59,409,512 F574S probably damaging Het
Clpb A T 7: 101,763,656 I317F probably damaging Het
Cnga3 T A 1: 37,261,873 V558D possibly damaging Het
Col9a1 C T 1: 24,222,473 P573S probably damaging Het
Crat A T 2: 30,413,061 D71E probably benign Het
Cspg4 A G 9: 56,887,101 T707A probably benign Het
Ctsr T A 13: 61,162,445 R132S probably benign Het
Ctu2 T C 8: 122,479,285 L255P probably damaging Het
Cyp2c69 T C 19: 39,849,366 Y424C probably damaging Het
Ddx27 A T 2: 167,034,109 K726N probably damaging Het
Dennd4a A G 9: 64,842,490 Q121R probably damaging Het
Dis3 A G 14: 99,097,590 F192S probably benign Het
Ect2l C T 10: 18,144,635 S487N probably benign Het
Eml1 T A 12: 108,521,396 F524L possibly damaging Het
Espl1 T C 15: 102,305,042 I601T probably benign Het
Fbxo40 C A 16: 36,969,351 V466L probably damaging Het
Frmpd1 C T 4: 45,283,711 T844M probably damaging Het
Frs2 T A 10: 117,081,106 probably benign Het
Fuom G T 7: 140,099,608 T133K probably benign Het
Garnl3 T A 2: 33,005,200 H619L probably damaging Het
Gm4861 G T 3: 137,552,115 N36K unknown Het
Gm6588 C A 5: 112,449,801 C71* probably null Het
Gps2 G T 11: 69,915,369 M153I probably benign Het
Gtf2ird1 A G 5: 134,415,245 V52A probably damaging Het
Gtpbp8 A T 16: 44,745,422 D137E probably benign Het
Haus4 A G 14: 54,544,276 C213R probably damaging Het
Hdc T A 2: 126,606,397 H142L possibly damaging Het
Hephl1 T C 9: 15,053,987 D1069G possibly damaging Het
Herc6 T A 6: 57,625,941 V535D probably damaging Het
Hipk3 A T 2: 104,430,188 H1082Q possibly damaging Het
Hps5 A T 7: 46,773,267 V513D probably damaging Het
Ifna13 T A 4: 88,644,175 I71F probably damaging Het
Il1rl2 T C 1: 40,363,324 I426T probably damaging Het
Irf5 A T 6: 29,536,739 D483V probably benign Het
Jakmip3 A G 7: 139,020,138 R256G probably damaging Het
Jazf1 T C 6: 52,777,615 I159V probably damaging Het
Kmo A G 1: 175,651,588 D230G possibly damaging Het
Lrrc74b A G 16: 17,553,194 V213A probably benign Het
Ly6g5b T C 17: 35,114,728 D36G possibly damaging Het
Macc1 T G 12: 119,445,731 L78R probably damaging Het
Mettl4 A T 17: 94,747,857 D51E possibly damaging Het
Mfap1a G A 2: 121,502,354 L199F possibly damaging Het
Mmp17 G T 5: 129,602,126 R363L probably damaging Het
Mrc1 G A 2: 14,319,241 A1130T possibly damaging Het
Mrpl15 C T 1: 4,777,582 A165T probably damaging Het
Mrpl45 G A 11: 97,315,944 probably null Het
Ms4a3 C T 19: 11,635,840 A85T possibly damaging Het
Mttp A T 3: 138,125,121 D77E probably benign Het
Muc6 A G 7: 141,637,098 L2489P probably damaging Het
Myl3 G A 9: 110,766,734 E100K probably damaging Het
Nbea T A 3: 56,085,322 N288Y probably damaging Het
Ncoa7 A G 10: 30,698,170 V181A probably benign Het
Oat C T 7: 132,558,205 V429M probably benign Het
Olfr1152 G A 2: 87,868,461 V157I probably benign Het
Olfr1163 A T 2: 88,070,956 L142Q probably damaging Het
Olfr1269 T G 2: 90,119,083 I172L probably damaging Het
Olfr285 T A 15: 98,313,380 M57L probably damaging Het
Olfr319 A T 11: 58,702,623 *307C probably null Het
Olfr508 T C 7: 108,630,838 I282T probably benign Het
Olfr524 A G 7: 140,202,231 F180L probably benign Het
Olfr810 T A 10: 129,790,890 K233M probably damaging Het
Olfr922 A G 9: 38,815,850 T116A probably benign Het
Oraov1 A G 7: 144,916,468 S45G probably damaging Het
Otof A G 5: 30,376,369 S1464P probably benign Het
Otogl A T 10: 107,777,575 Y2010N probably damaging Het
Pgap3 C T 11: 98,400,214 probably null Het
Pgbd5 T A 8: 124,374,249 K332* probably null Het
Pgs1 C T 11: 118,005,727 P410L probably damaging Het
Pkhd1l1 G A 15: 44,500,038 S618N probably benign Het
Plcb1 A T 2: 135,386,302 D1073V probably damaging Het
Pola2 T A 19: 5,951,180 T309S probably benign Het
Polg2 T A 11: 106,778,961 H161L probably damaging Het
Postn T A 3: 54,377,612 probably null Het
Ppt1 G T 4: 122,845,991 C128F probably damaging Het
Ptpn12 G A 5: 20,993,263 P678S probably damaging Het
Rcan3 A T 4: 135,412,501 probably null Het
Rgs22 T C 15: 36,101,804 N216S probably benign Het
Rgs7bp T A 13: 104,951,582 D228V probably damaging Het
Rhobtb2 A T 14: 69,796,613 S388T probably benign Het
Rnps1 C T 17: 24,420,390 R138C unknown Het
Rpl38 T C 11: 114,671,776 V36A probably benign Het
Rps7 G T 12: 28,631,753 H126Q possibly damaging Het
Sec24b G T 3: 129,991,361 Q999K possibly damaging Het
Slc19a3 A G 1: 83,019,368 V373A possibly damaging Het
Spats2l T A 1: 57,885,782 V113E probably benign Het
Ss18l1 A T 2: 180,063,345 T377S unknown Het
Surf1 A G 2: 26,915,970 F38L probably benign Het
Ticrr G A 7: 79,675,394 R556H probably damaging Het
Tmem184b A G 15: 79,365,814 S254P probably damaging Het
Tnfrsf4 G T 4: 156,016,235 R237L possibly damaging Het
Tnk2 C A 16: 32,663,742 probably benign Het
Tnks A T 8: 34,838,530 D1191E probably damaging Het
Tnr C A 1: 159,895,037 Y1017* probably null Het
Tomm34 A G 2: 164,061,006 I128T probably benign Het
Trim2 G A 3: 84,177,792 S540F possibly damaging Het
Ttc24 T C 3: 88,074,874 E17G probably benign Het
Ttc41 A G 10: 86,776,214 H1117R probably benign Het
Ttn A T 2: 76,735,408 V28200D probably damaging Het
Ttn A T 2: 76,762,386 S20801T possibly damaging Het
Ube2cbp C T 9: 86,448,787 C114Y probably damaging Het
Ugt2b37 A C 5: 87,240,857 L499R probably damaging Het
Vmn1r81 T C 7: 12,260,662 I6M possibly damaging Het
Vmn2r97 A T 17: 18,929,331 Y327F probably benign Het
Vps13b T C 15: 35,709,507 S1867P probably damaging Het
Wdr11 T C 7: 129,606,607 V362A probably benign Het
Zan T A 5: 137,388,939 M4951L unknown Het
Zcwpw1 T A 5: 137,811,622 L337Q probably damaging Het
Zfp2 A T 11: 50,899,982 D411E possibly damaging Het
Zfp628 C T 7: 4,920,768 T663I probably benign Het
Zfpm1 T A 8: 122,334,924 probably null Het
Zfyve19 T C 2: 119,211,212 S87P probably benign Het
Zswim9 T A 7: 13,260,214 K672* probably null Het
Other mutations in Trio
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00480:Trio APN 15 27912743 splice site probably benign
IGL01011:Trio APN 15 27736489 missense probably damaging 0.96
IGL01090:Trio APN 15 27773007 missense probably damaging 1.00
IGL01145:Trio APN 15 27818167 splice site probably benign
IGL01147:Trio APN 15 27881320 missense probably damaging 1.00
IGL01161:Trio APN 15 27749781 missense probably damaging 1.00
IGL01324:Trio APN 15 27905323 missense probably benign 0.42
IGL01352:Trio APN 15 27901229 missense probably benign 0.01
IGL01366:Trio APN 15 27732868 missense possibly damaging 0.76
IGL01443:Trio APN 15 27838775 splice site probably benign
IGL01454:Trio APN 15 27832985 missense probably benign 0.32
IGL01695:Trio APN 15 27773001 missense probably damaging 1.00
IGL01765:Trio APN 15 27764026 missense possibly damaging 0.85
IGL01860:Trio APN 15 27846810 missense probably damaging 1.00
IGL01879:Trio APN 15 27741033 missense probably benign 0.12
IGL01991:Trio APN 15 27871274 missense possibly damaging 0.95
IGL02106:Trio APN 15 27744158 missense possibly damaging 0.85
IGL02209:Trio APN 15 27744053 missense probably damaging 1.00
IGL02232:Trio APN 15 27902561 missense probably benign 0.24
IGL02304:Trio APN 15 27735436 missense probably damaging 0.96
IGL02504:Trio APN 15 27847390 nonsense probably null
IGL02508:Trio APN 15 27818104 missense possibly damaging 0.65
IGL02541:Trio APN 15 27844930 splice site probably benign
IGL02617:Trio APN 15 27841849 splice site probably benign
IGL02675:Trio APN 15 27768039 unclassified probably benign
IGL02817:Trio APN 15 27902881 missense probably benign 0.01
IGL02993:Trio APN 15 27830239 splice site probably benign
IGL03007:Trio APN 15 27902742 missense probably damaging 0.99
IGL03135:Trio APN 15 27832011 splice site probably benign
IGL03225:Trio APN 15 27902695 missense probably benign 0.30
R0063:Trio UTSW 15 27881437 splice site probably benign
R0063:Trio UTSW 15 27881437 splice site probably benign
R0302:Trio UTSW 15 27902517 missense probably damaging 1.00
R0505:Trio UTSW 15 27767907 missense probably benign 0.00
R0506:Trio UTSW 15 27854963 missense probably benign 0.12
R0564:Trio UTSW 15 27805822 missense probably damaging 1.00
R0659:Trio UTSW 15 27831399 missense probably damaging 0.97
R0882:Trio UTSW 15 27732894 missense probably damaging 1.00
R0939:Trio UTSW 15 27741250 critical splice donor site probably null
R1018:Trio UTSW 15 27871171 missense probably damaging 1.00
R1439:Trio UTSW 15 27897914 missense probably damaging 1.00
R1456:Trio UTSW 15 27753804 splice site probably benign
R1488:Trio UTSW 15 27740967 missense probably damaging 1.00
R1522:Trio UTSW 15 27732640 missense probably benign 0.28
R1531:Trio UTSW 15 27832985 missense probably benign 0.32
R1640:Trio UTSW 15 27833044 missense probably damaging 1.00
R1646:Trio UTSW 15 27758347 missense possibly damaging 0.91
R1682:Trio UTSW 15 27744146 unclassified probably null
R1780:Trio UTSW 15 27744038 missense possibly damaging 0.93
R1791:Trio UTSW 15 27841756 missense probably damaging 1.00
R1803:Trio UTSW 15 27748340 missense probably benign
R1817:Trio UTSW 15 27742495 nonsense probably null
R1853:Trio UTSW 15 27756536 missense probably damaging 1.00
R1898:Trio UTSW 15 27742380 missense possibly damaging 0.52
R1937:Trio UTSW 15 27833056 missense probably damaging 1.00
R2025:Trio UTSW 15 27744137 missense probably damaging 0.99
R2025:Trio UTSW 15 27773927 missense probably damaging 1.00
R2050:Trio UTSW 15 27851945 missense possibly damaging 0.85
R2186:Trio UTSW 15 27823975 splice site probably null
R2913:Trio UTSW 15 27854912 missense probably damaging 1.00
R3151:Trio UTSW 15 27805776 missense probably damaging 1.00
R3771:Trio UTSW 15 27748091 missense probably damaging 0.98
R3773:Trio UTSW 15 27748091 missense probably damaging 0.98
R3826:Trio UTSW 15 27833070 missense probably damaging 1.00
R4015:Trio UTSW 15 27744101 missense possibly damaging 0.71
R4359:Trio UTSW 15 27749797 nonsense probably null
R4370:Trio UTSW 15 27748337 nonsense probably null
R4547:Trio UTSW 15 27818982 missense possibly damaging 0.89
R4573:Trio UTSW 15 27772998 small deletion probably benign
R4620:Trio UTSW 15 27871171 missense probably damaging 1.00
R4735:Trio UTSW 15 27752789 splice site probably null
R4764:Trio UTSW 15 27732538 nonsense probably null
R4775:Trio UTSW 15 27881342 nonsense probably null
R4942:Trio UTSW 15 27752725 missense probably benign 0.21
R5004:Trio UTSW 15 27755178 missense probably damaging 1.00
R5149:Trio UTSW 15 27754029 missense possibly damaging 0.74
R5183:Trio UTSW 15 27902600 missense probably benign 0.00
R5186:Trio UTSW 15 27897991 missense probably damaging 0.97
R5268:Trio UTSW 15 27748286 missense probably benign 0.02
R5344:Trio UTSW 15 27735532 missense probably benign 0.12
R5407:Trio UTSW 15 27844806 splice site probably null
R5442:Trio UTSW 15 27856194 missense probably benign 0.04
R5617:Trio UTSW 15 27902748 missense probably benign
R5778:Trio UTSW 15 27856164 missense probably benign 0.33
R5986:Trio UTSW 15 27851933 missense possibly damaging 0.88
R5990:Trio UTSW 15 27891459 missense probably benign 0.10
R6011:Trio UTSW 15 27735545 missense probably damaging 0.98
R6063:Trio UTSW 15 27891379 missense possibly damaging 0.94
R6166:Trio UTSW 15 27818071 missense probably damaging 0.96
R6187:Trio UTSW 15 27743952 critical splice donor site probably null
R6387:Trio UTSW 15 27752739 missense probably damaging 1.00
R6402:Trio UTSW 15 27902911 missense probably benign 0.02
R6478:Trio UTSW 15 27856107 missense probably benign 0.01
R6528:Trio UTSW 15 27805870 missense probably damaging 1.00
R6662:Trio UTSW 15 27854996 missense probably benign 0.00
R6825:Trio UTSW 15 27889308 missense probably damaging 0.98
R6890:Trio UTSW 15 27919288 unclassified probably benign
R6945:Trio UTSW 15 27824090 missense probably damaging 1.00
R7027:Trio UTSW 15 27805654 missense possibly damaging 0.86
R7046:Trio UTSW 15 27832051 missense probably damaging 1.00
R7049:Trio UTSW 15 27749799 missense possibly damaging 0.66
R7075:Trio UTSW 15 27898000 missense unknown
R7094:Trio UTSW 15 27891448 missense unknown
R7123:Trio UTSW 15 27742313 critical splice donor site probably benign
R7130:Trio UTSW 15 27742313 critical splice donor site probably benign
R7214:Trio UTSW 15 27871187 missense probably damaging 0.97
R7292:Trio UTSW 15 27828351 missense possibly damaging 0.63
R7293:Trio UTSW 15 27871289 missense possibly damaging 0.66
R7352:Trio UTSW 15 27732876 missense probably damaging 0.96
R7426:Trio UTSW 15 27856107 missense probably benign 0.01
R7451:Trio UTSW 15 27747913 missense probably benign 0.07
R7558:Trio UTSW 15 27831394 missense possibly damaging 0.90
R7578:Trio UTSW 15 27854939 missense possibly damaging 0.94
R7596:Trio UTSW 15 27749826 missense probably damaging 0.99
R7604:Trio UTSW 15 27736445 critical splice donor site probably null
R7609:Trio UTSW 15 27912642 missense unknown
X0024:Trio UTSW 15 27765726 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- CACGAATTCTTTGGCCTTCTGG -3'
(R):5'- AGAGGATCCTGACAGTGGTC -3'

Sequencing Primer
(F):5'- GGCTAACTCCTTGAAAGTAGTCC -3'
(R):5'- ATTAGGGATGTTTGCCAATGACG -3'
Posted On2014-07-14