Incidental Mutation 'R1938:Vps13b'
ID 213745
Institutional Source Beutler Lab
Gene Symbol Vps13b
Ensembl Gene ENSMUSG00000037646
Gene Name vacuolar protein sorting 13B
Synonyms 1810042B05Rik, C330002D13Rik, 2310042E16Rik, Coh1
MMRRC Submission 039956-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1938 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 35371306-35931375 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 35709653 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 1867 (S1867P)
Ref Sequence ENSEMBL: ENSMUSP00000045490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048646]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000048646
AA Change: S1867P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000045490
Gene: ENSMUSG00000037646
AA Change: S1867P

DomainStartEndE-ValueType
Pfam:Chorein_N 2 120 1e-29 PFAM
low complexity region 128 137 N/A INTRINSIC
low complexity region 143 160 N/A INTRINSIC
low complexity region 975 984 N/A INTRINSIC
low complexity region 1007 1018 N/A INTRINSIC
low complexity region 1876 1883 N/A INTRINSIC
low complexity region 2042 2054 N/A INTRINSIC
low complexity region 2414 2423 N/A INTRINSIC
Pfam:SHR-BD 2601 2700 8.4e-10 PFAM
low complexity region 2954 2964 N/A INTRINSIC
Pfam:VPS13_C 3539 3706 2.6e-30 PFAM
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a potential transmembrane protein that may function in vesicle-mediated transport and sorting of proteins within the cell. This protein may play a role in the development and the function of the eye, hematological system, and central nervous system. Mutations in this gene have been associated with Cohen syndrome. Multiple splice variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 133 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 T C 7: 45,824,795 (GRCm39) K134R possibly damaging Het
Adamts17 T C 7: 66,774,820 (GRCm39) S980P probably damaging Het
Adap2 T A 11: 80,061,508 (GRCm39) I221K probably damaging Het
Adgrv1 C T 13: 81,539,876 (GRCm39) R5681Q probably damaging Het
Adipor1 T A 1: 134,350,841 (GRCm39) L30Q probably benign Het
Agpat5 A G 8: 18,928,181 (GRCm39) T249A probably benign Het
Agxt2 G T 15: 10,392,021 (GRCm39) G329V probably damaging Het
Ankrd28 A G 14: 31,427,233 (GRCm39) V801A possibly damaging Het
Ap1g2 A G 14: 55,337,229 (GRCm39) V702A possibly damaging Het
Arid3a A G 10: 79,786,540 (GRCm39) Q429R probably damaging Het
Arsb T A 13: 93,998,658 (GRCm39) L322Q probably damaging Het
Ash1l A G 3: 88,891,729 (GRCm39) T1203A probably damaging Het
Atad2 T A 15: 57,960,101 (GRCm39) N1308Y possibly damaging Het
Atp10b A T 11: 43,121,245 (GRCm39) R969S probably benign Het
Bmp10 T C 6: 87,410,702 (GRCm39) I165T possibly damaging Het
Ccdc121rt2 C A 5: 112,597,667 (GRCm39) C71* probably null Het
Ccne1 A G 7: 37,805,702 (GRCm39) probably null Het
Cenpe A G 3: 134,953,240 (GRCm39) N1565D probably damaging Het
Chd1 A T 17: 15,982,748 (GRCm39) E1404D probably benign Het
Chd7 G A 4: 8,847,200 (GRCm39) E1648K probably damaging Het
Chodl T C 16: 78,738,314 (GRCm39) I94T possibly damaging Het
Chsy3 T C 18: 59,542,584 (GRCm39) F574S probably damaging Het
Clpb A T 7: 101,412,863 (GRCm39) I317F probably damaging Het
Cnga3 T A 1: 37,300,954 (GRCm39) V558D possibly damaging Het
Col9a1 C T 1: 24,261,554 (GRCm39) P573S probably damaging Het
Crat A T 2: 30,303,073 (GRCm39) D71E probably benign Het
Cspg4 A G 9: 56,794,385 (GRCm39) T707A probably benign Het
Ctsr T A 13: 61,310,259 (GRCm39) R132S probably benign Het
Ctu2 T C 8: 123,206,024 (GRCm39) L255P probably damaging Het
Cyp2c69 T C 19: 39,837,810 (GRCm39) Y424C probably damaging Het
Ddx27 A T 2: 166,876,029 (GRCm39) K726N probably damaging Het
Dennd4a A G 9: 64,749,772 (GRCm39) Q121R probably damaging Het
Dis3 A G 14: 99,335,026 (GRCm39) F192S probably benign Het
Ect2l C T 10: 18,020,383 (GRCm39) S487N probably benign Het
Eml1 T A 12: 108,487,655 (GRCm39) F524L possibly damaging Het
Espl1 T C 15: 102,213,477 (GRCm39) I601T probably benign Het
Fbxo40 C A 16: 36,789,713 (GRCm39) V466L probably damaging Het
Frmpd1 C T 4: 45,283,711 (GRCm39) T844M probably damaging Het
Frs2 T A 10: 116,917,011 (GRCm39) probably benign Het
Fuom G T 7: 139,679,521 (GRCm39) T133K probably benign Het
Garnl3 T A 2: 32,895,212 (GRCm39) H619L probably damaging Het
Gm4861 G T 3: 137,257,876 (GRCm39) N36K unknown Het
Gps2 G T 11: 69,806,195 (GRCm39) M153I probably benign Het
Gtf2ird1 A G 5: 134,444,099 (GRCm39) V52A probably damaging Het
Gtpbp8 A T 16: 44,565,785 (GRCm39) D137E probably benign Het
Haus4 A G 14: 54,781,733 (GRCm39) C213R probably damaging Het
Hdc T A 2: 126,448,317 (GRCm39) H142L possibly damaging Het
Hephl1 T C 9: 14,965,283 (GRCm39) D1069G possibly damaging Het
Herc6 T A 6: 57,602,926 (GRCm39) V535D probably damaging Het
Hipk3 A T 2: 104,260,533 (GRCm39) H1082Q possibly damaging Het
Hps5 A T 7: 46,422,691 (GRCm39) V513D probably damaging Het
Ifna13 T A 4: 88,562,412 (GRCm39) I71F probably damaging Het
Il1rl2 T C 1: 40,402,484 (GRCm39) I426T probably damaging Het
Irf5 A T 6: 29,536,738 (GRCm39) D483V probably benign Het
Jakmip3 A G 7: 138,621,867 (GRCm39) R256G probably damaging Het
Jazf1 T C 6: 52,754,600 (GRCm39) I159V probably damaging Het
Kmo A G 1: 175,479,154 (GRCm39) D230G possibly damaging Het
Lrrc74b A G 16: 17,371,058 (GRCm39) V213A probably benign Het
LTO1 A G 7: 144,470,205 (GRCm39) S45G probably damaging Het
Ly6g5b T C 17: 35,333,704 (GRCm39) D36G possibly damaging Het
Mab21l4 T C 1: 93,079,730 (GRCm39) *453W probably null Het
Macc1 T G 12: 119,409,466 (GRCm39) L78R probably damaging Het
Mettl4 A T 17: 95,055,285 (GRCm39) D51E possibly damaging Het
Mfap1a G A 2: 121,332,835 (GRCm39) L199F possibly damaging Het
Mmp17 G T 5: 129,679,190 (GRCm39) R363L probably damaging Het
Mrc1 G A 2: 14,324,052 (GRCm39) A1130T possibly damaging Het
Mrpl15 C T 1: 4,847,805 (GRCm39) A165T probably damaging Het
Mrpl45 G A 11: 97,206,770 (GRCm39) probably null Het
Ms4a3 C T 19: 11,613,204 (GRCm39) A85T possibly damaging Het
Mttp A T 3: 137,830,882 (GRCm39) D77E probably benign Het
Muc6 A G 7: 141,217,011 (GRCm39) L2489P probably damaging Het
Myl3 G A 9: 110,595,802 (GRCm39) E100K probably damaging Het
Nbea T A 3: 55,992,743 (GRCm39) N288Y probably damaging Het
Ncoa7 A G 10: 30,574,166 (GRCm39) V181A probably benign Het
Oat C T 7: 132,159,934 (GRCm39) V429M probably benign Het
Or2ak6 A T 11: 58,593,449 (GRCm39) *307C probably null Het
Or4x6 T G 2: 89,949,427 (GRCm39) I172L probably damaging Het
Or5d36 A T 2: 87,901,300 (GRCm39) L142Q probably damaging Het
Or5p80 T C 7: 108,230,045 (GRCm39) I282T probably benign Het
Or5w19 G A 2: 87,698,805 (GRCm39) V157I probably benign Het
Or6b13 A G 7: 139,782,144 (GRCm39) F180L probably benign Het
Or6c69b T A 10: 129,626,759 (GRCm39) K233M probably damaging Het
Or8b55 A G 9: 38,727,146 (GRCm39) T116A probably benign Het
Or8s16 T A 15: 98,211,261 (GRCm39) M57L probably damaging Het
Otof A G 5: 30,533,713 (GRCm39) S1464P probably benign Het
Otogl A T 10: 107,613,436 (GRCm39) Y2010N probably damaging Het
Pgap3 C T 11: 98,291,040 (GRCm39) probably null Het
Pgbd5 T A 8: 125,100,988 (GRCm39) K332* probably null Het
Pgs1 C T 11: 117,896,553 (GRCm39) P410L probably damaging Het
Pkhd1l1 G A 15: 44,363,434 (GRCm39) S618N probably benign Het
Plcb1 A T 2: 135,228,222 (GRCm39) D1073V probably damaging Het
Pola2 T A 19: 6,001,208 (GRCm39) T309S probably benign Het
Polg2 T A 11: 106,669,787 (GRCm39) H161L probably damaging Het
Postn T A 3: 54,285,033 (GRCm39) probably null Het
Ppt1 G T 4: 122,739,784 (GRCm39) C128F probably damaging Het
Ptpn12 G A 5: 21,198,261 (GRCm39) P678S probably damaging Het
Rcan3 A T 4: 135,139,812 (GRCm39) probably null Het
Rgs22 T C 15: 36,101,950 (GRCm39) N216S probably benign Het
Rgs7bp T A 13: 105,088,090 (GRCm39) D228V probably damaging Het
Rhobtb2 A T 14: 70,034,062 (GRCm39) S388T probably benign Het
Rnps1 C T 17: 24,639,364 (GRCm39) R138C unknown Het
Rpl38 T C 11: 114,562,602 (GRCm39) V36A probably benign Het
Rps7 G T 12: 28,681,752 (GRCm39) H126Q possibly damaging Het
Sec24b G T 3: 129,785,010 (GRCm39) Q999K possibly damaging Het
Slc19a3 A G 1: 82,997,089 (GRCm39) V373A possibly damaging Het
Spats2l T A 1: 57,924,941 (GRCm39) V113E probably benign Het
Ss18l1 A T 2: 179,705,138 (GRCm39) T377S unknown Het
Surf1 A G 2: 26,805,982 (GRCm39) F38L probably benign Het
Ticrr G A 7: 79,325,142 (GRCm39) R556H probably damaging Het
Tmem184b A G 15: 79,250,014 (GRCm39) S254P probably damaging Het
Tnfrsf4 G T 4: 156,100,692 (GRCm39) R237L possibly damaging Het
Tnk2 C A 16: 32,482,560 (GRCm39) probably benign Het
Tnks A T 8: 35,305,684 (GRCm39) D1191E probably damaging Het
Tnr C A 1: 159,722,607 (GRCm39) Y1017* probably null Het
Tomm34 A G 2: 163,902,926 (GRCm39) I128T probably benign Het
Trim2 G A 3: 84,085,099 (GRCm39) S540F possibly damaging Het
Trio A T 15: 27,732,977 (GRCm39) I2968N probably damaging Het
Ttc24 T C 3: 87,982,181 (GRCm39) E17G probably benign Het
Ttc41 A G 10: 86,612,078 (GRCm39) H1117R probably benign Het
Ttn A T 2: 76,565,752 (GRCm39) V28200D probably damaging Het
Ttn A T 2: 76,592,730 (GRCm39) S20801T possibly damaging Het
Ube3d C T 9: 86,330,840 (GRCm39) C114Y probably damaging Het
Ugt2b37 A C 5: 87,388,716 (GRCm39) L499R probably damaging Het
Vmn1r81 T C 7: 11,994,589 (GRCm39) I6M possibly damaging Het
Vmn2r97 A T 17: 19,149,593 (GRCm39) Y327F probably benign Het
Wdr11 T C 7: 129,208,331 (GRCm39) V362A probably benign Het
Zan T A 5: 137,387,201 (GRCm39) M4951L unknown Het
Zcwpw1 T A 5: 137,809,884 (GRCm39) L337Q probably damaging Het
Zfp2 A T 11: 50,790,809 (GRCm39) D411E possibly damaging Het
Zfp628 C T 7: 4,923,767 (GRCm39) T663I probably benign Het
Zfpm1 T A 8: 123,061,663 (GRCm39) probably null Het
Zfyve19 T C 2: 119,041,693 (GRCm39) S87P probably benign Het
Zswim9 T A 7: 12,994,141 (GRCm39) K672* probably null Het
Other mutations in Vps13b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Vps13b APN 15 35,926,372 (GRCm39) missense possibly damaging 0.52
IGL00513:Vps13b APN 15 35,794,030 (GRCm39) missense probably damaging 1.00
IGL00516:Vps13b APN 15 35,640,703 (GRCm39) missense probably damaging 1.00
IGL00640:Vps13b APN 15 35,417,723 (GRCm39) missense probably benign
IGL00753:Vps13b APN 15 35,372,177 (GRCm39) missense probably damaging 0.99
IGL00784:Vps13b APN 15 35,847,046 (GRCm39) missense probably damaging 1.00
IGL01138:Vps13b APN 15 35,446,916 (GRCm39) splice site probably benign
IGL01349:Vps13b APN 15 35,794,091 (GRCm39) missense probably benign 0.00
IGL01403:Vps13b APN 15 35,709,625 (GRCm39) missense probably benign 0.00
IGL01535:Vps13b APN 15 35,455,103 (GRCm39) missense possibly damaging 0.67
IGL01571:Vps13b APN 15 35,877,635 (GRCm39) splice site probably benign
IGL01642:Vps13b APN 15 35,792,218 (GRCm39) missense probably benign 0.43
IGL01658:Vps13b APN 15 35,671,479 (GRCm39) missense probably damaging 0.99
IGL01759:Vps13b APN 15 35,878,935 (GRCm39) missense probably damaging 1.00
IGL01763:Vps13b APN 15 35,709,945 (GRCm39) missense possibly damaging 0.72
IGL01906:Vps13b APN 15 35,639,993 (GRCm39) splice site probably benign
IGL01982:Vps13b APN 15 35,439,050 (GRCm39) nonsense probably null
IGL01997:Vps13b APN 15 35,709,370 (GRCm39) missense probably damaging 1.00
IGL02041:Vps13b APN 15 35,423,391 (GRCm39) missense probably damaging 0.98
IGL02073:Vps13b APN 15 35,875,732 (GRCm39) missense possibly damaging 0.52
IGL02077:Vps13b APN 15 35,910,759 (GRCm39) missense possibly damaging 0.68
IGL02141:Vps13b APN 15 35,572,227 (GRCm39) missense probably benign 0.09
IGL02146:Vps13b APN 15 35,646,479 (GRCm39) missense probably benign 0.36
IGL02197:Vps13b APN 15 35,930,202 (GRCm39) missense probably benign 0.02
IGL02311:Vps13b APN 15 35,709,660 (GRCm39) missense probably benign 0.08
IGL02466:Vps13b APN 15 35,770,887 (GRCm39) missense possibly damaging 0.86
IGL02506:Vps13b APN 15 35,917,308 (GRCm39) missense probably damaging 1.00
IGL02550:Vps13b APN 15 35,572,242 (GRCm39) missense probably benign
IGL02553:Vps13b APN 15 35,646,447 (GRCm39) missense probably benign 0.00
IGL02674:Vps13b APN 15 35,640,104 (GRCm39) missense probably benign 0.41
IGL02690:Vps13b APN 15 35,917,288 (GRCm39) missense probably damaging 1.00
IGL02731:Vps13b APN 15 35,917,274 (GRCm39) missense probably benign 0.00
IGL02739:Vps13b APN 15 35,880,046 (GRCm39) missense probably damaging 1.00
IGL02868:Vps13b APN 15 35,884,665 (GRCm39) missense probably benign 0.03
IGL03081:Vps13b APN 15 35,875,966 (GRCm39) missense probably damaging 0.97
IGL03178:Vps13b APN 15 35,869,446 (GRCm39) missense probably damaging 1.00
IGL03343:Vps13b APN 15 35,917,316 (GRCm39) missense possibly damaging 0.76
IGL03407:Vps13b APN 15 35,640,012 (GRCm39) missense possibly damaging 0.95
IGL03410:Vps13b APN 15 35,910,486 (GRCm39) missense probably benign
omlette UTSW 15 35,671,546 (GRCm39) missense probably benign 0.13
swiss UTSW 15 35,709,819 (GRCm39) missense possibly damaging 0.80
FR4449:Vps13b UTSW 15 35,847,103 (GRCm39) missense probably damaging 1.00
FR4548:Vps13b UTSW 15 35,847,103 (GRCm39) missense probably damaging 1.00
FR4737:Vps13b UTSW 15 35,847,103 (GRCm39) missense probably damaging 1.00
FR4976:Vps13b UTSW 15 35,847,103 (GRCm39) missense probably damaging 1.00
LCD18:Vps13b UTSW 15 35,847,103 (GRCm39) missense probably damaging 1.00
PIT4531001:Vps13b UTSW 15 35,878,971 (GRCm39) missense probably damaging 1.00
PIT4581001:Vps13b UTSW 15 35,534,409 (GRCm39) missense probably damaging 1.00
PIT4618001:Vps13b UTSW 15 35,709,386 (GRCm39) missense probably damaging 1.00
R0026:Vps13b UTSW 15 35,923,447 (GRCm39) missense possibly damaging 0.62
R0026:Vps13b UTSW 15 35,923,447 (GRCm39) missense possibly damaging 0.62
R0108:Vps13b UTSW 15 35,572,265 (GRCm39) missense probably benign 0.20
R0109:Vps13b UTSW 15 35,572,265 (GRCm39) missense probably benign 0.20
R0109:Vps13b UTSW 15 35,572,265 (GRCm39) missense probably benign 0.20
R0116:Vps13b UTSW 15 35,423,301 (GRCm39) missense probably damaging 0.99
R0123:Vps13b UTSW 15 35,887,407 (GRCm39) missense probably benign 0.01
R0124:Vps13b UTSW 15 35,576,674 (GRCm39) critical splice donor site probably null
R0134:Vps13b UTSW 15 35,887,407 (GRCm39) missense probably benign 0.01
R0137:Vps13b UTSW 15 35,926,365 (GRCm39) missense probably benign 0.06
R0195:Vps13b UTSW 15 35,472,045 (GRCm39) missense probably benign 0.00
R0225:Vps13b UTSW 15 35,887,407 (GRCm39) missense probably benign 0.01
R0320:Vps13b UTSW 15 35,674,974 (GRCm39) missense probably damaging 0.98
R0333:Vps13b UTSW 15 35,879,949 (GRCm39) missense probably damaging 1.00
R0336:Vps13b UTSW 15 35,455,279 (GRCm39) nonsense probably null
R0463:Vps13b UTSW 15 35,597,555 (GRCm39) missense probably damaging 0.98
R0466:Vps13b UTSW 15 35,445,748 (GRCm39) nonsense probably null
R0472:Vps13b UTSW 15 35,417,779 (GRCm39) critical splice donor site probably null
R0523:Vps13b UTSW 15 35,472,196 (GRCm39) missense probably benign 0.20
R0602:Vps13b UTSW 15 35,422,514 (GRCm39) missense probably damaging 1.00
R0612:Vps13b UTSW 15 35,623,803 (GRCm39) missense probably benign 0.12
R0627:Vps13b UTSW 15 35,372,145 (GRCm39) nonsense probably null
R0679:Vps13b UTSW 15 35,709,849 (GRCm39) missense possibly damaging 0.73
R0742:Vps13b UTSW 15 35,794,507 (GRCm39) missense probably benign 0.22
R1053:Vps13b UTSW 15 35,652,509 (GRCm39) missense probably damaging 1.00
R1355:Vps13b UTSW 15 35,422,600 (GRCm39) missense probably damaging 1.00
R1386:Vps13b UTSW 15 35,923,458 (GRCm39) missense probably damaging 0.99
R1403:Vps13b UTSW 15 35,709,268 (GRCm39) splice site probably benign
R1453:Vps13b UTSW 15 35,422,590 (GRCm39) missense probably damaging 0.97
R1464:Vps13b UTSW 15 35,709,630 (GRCm39) missense probably benign 0.14
R1464:Vps13b UTSW 15 35,709,630 (GRCm39) missense probably benign 0.14
R1511:Vps13b UTSW 15 35,841,719 (GRCm39) missense probably benign 0.00
R1511:Vps13b UTSW 15 35,840,121 (GRCm39) missense probably damaging 0.99
R1513:Vps13b UTSW 15 35,438,876 (GRCm39) nonsense probably null
R1536:Vps13b UTSW 15 35,875,712 (GRCm39) missense probably damaging 0.98
R1537:Vps13b UTSW 15 35,792,327 (GRCm39) missense possibly damaging 0.62
R1558:Vps13b UTSW 15 35,534,465 (GRCm39) missense probably damaging 1.00
R1601:Vps13b UTSW 15 35,642,582 (GRCm39) missense probably benign 0.11
R1653:Vps13b UTSW 15 35,607,418 (GRCm39) nonsense probably null
R1695:Vps13b UTSW 15 35,576,667 (GRCm39) missense probably benign 0.05
R1760:Vps13b UTSW 15 35,884,765 (GRCm39) missense possibly damaging 0.54
R1785:Vps13b UTSW 15 35,879,937 (GRCm39) missense probably damaging 1.00
R1786:Vps13b UTSW 15 35,879,937 (GRCm39) missense probably damaging 1.00
R1803:Vps13b UTSW 15 35,430,351 (GRCm39) nonsense probably null
R1804:Vps13b UTSW 15 35,917,283 (GRCm39) missense probably damaging 1.00
R1808:Vps13b UTSW 15 35,792,205 (GRCm39) missense probably benign 0.00
R1817:Vps13b UTSW 15 35,910,788 (GRCm39) missense possibly damaging 0.86
R1818:Vps13b UTSW 15 35,877,723 (GRCm39) missense probably benign 0.00
R1836:Vps13b UTSW 15 35,910,378 (GRCm39) missense probably damaging 0.99
R1850:Vps13b UTSW 15 35,675,105 (GRCm39) splice site probably benign
R1884:Vps13b UTSW 15 35,430,437 (GRCm39) splice site probably benign
R1955:Vps13b UTSW 15 35,925,554 (GRCm39) critical splice donor site probably null
R1956:Vps13b UTSW 15 35,869,553 (GRCm39) missense probably damaging 1.00
R1958:Vps13b UTSW 15 35,878,835 (GRCm39) missense probably damaging 0.99
R2013:Vps13b UTSW 15 35,607,288 (GRCm39) missense probably damaging 0.99
R2014:Vps13b UTSW 15 35,607,288 (GRCm39) missense probably damaging 0.99
R2015:Vps13b UTSW 15 35,607,288 (GRCm39) missense probably damaging 0.99
R2038:Vps13b UTSW 15 35,884,887 (GRCm39) missense probably damaging 1.00
R2058:Vps13b UTSW 15 35,841,593 (GRCm39) missense probably damaging 1.00
R2082:Vps13b UTSW 15 35,910,892 (GRCm39) missense possibly damaging 0.70
R2087:Vps13b UTSW 15 35,597,639 (GRCm39) missense probably damaging 0.99
R2124:Vps13b UTSW 15 35,646,226 (GRCm39) missense probably benign 0.08
R2130:Vps13b UTSW 15 35,671,546 (GRCm39) missense probably benign 0.13
R2168:Vps13b UTSW 15 35,792,334 (GRCm39) missense probably damaging 1.00
R2168:Vps13b UTSW 15 35,792,335 (GRCm39) missense probably damaging 1.00
R2171:Vps13b UTSW 15 35,887,343 (GRCm39) missense probably benign 0.44
R2221:Vps13b UTSW 15 35,884,743 (GRCm39) missense probably benign
R2263:Vps13b UTSW 15 35,646,327 (GRCm39) missense probably benign 0.02
R2289:Vps13b UTSW 15 35,572,251 (GRCm39) missense probably damaging 1.00
R2316:Vps13b UTSW 15 35,675,045 (GRCm39) nonsense probably null
R2351:Vps13b UTSW 15 35,869,457 (GRCm39) missense probably damaging 1.00
R2512:Vps13b UTSW 15 35,884,701 (GRCm39) missense probably benign 0.35
R3054:Vps13b UTSW 15 35,646,507 (GRCm39) missense probably damaging 0.99
R3055:Vps13b UTSW 15 35,646,507 (GRCm39) missense probably damaging 0.99
R3196:Vps13b UTSW 15 35,869,541 (GRCm39) missense probably damaging 1.00
R3236:Vps13b UTSW 15 35,910,450 (GRCm39) missense probably benign 0.40
R3404:Vps13b UTSW 15 35,926,200 (GRCm39) missense probably damaging 1.00
R3722:Vps13b UTSW 15 35,671,528 (GRCm39) missense probably damaging 0.99
R4077:Vps13b UTSW 15 35,455,274 (GRCm39) missense probably damaging 0.99
R4153:Vps13b UTSW 15 35,792,173 (GRCm39) splice site probably null
R4224:Vps13b UTSW 15 35,876,565 (GRCm39) missense probably damaging 0.99
R4408:Vps13b UTSW 15 35,709,440 (GRCm39) missense probably damaging 0.98
R4431:Vps13b UTSW 15 35,770,899 (GRCm39) missense probably damaging 1.00
R4449:Vps13b UTSW 15 35,876,939 (GRCm39) missense possibly damaging 0.86
R4508:Vps13b UTSW 15 35,709,819 (GRCm39) missense possibly damaging 0.80
R4631:Vps13b UTSW 15 35,646,278 (GRCm39) missense possibly damaging 0.95
R4655:Vps13b UTSW 15 35,770,835 (GRCm39) missense probably benign
R4666:Vps13b UTSW 15 35,640,690 (GRCm39) missense probably benign 0.13
R4684:Vps13b UTSW 15 35,879,967 (GRCm39) missense probably benign
R4684:Vps13b UTSW 15 35,841,487 (GRCm39) missense probably benign
R4684:Vps13b UTSW 15 35,646,324 (GRCm39) missense probably damaging 0.98
R4721:Vps13b UTSW 15 35,910,864 (GRCm39) nonsense probably null
R4771:Vps13b UTSW 15 35,910,946 (GRCm39) missense probably damaging 1.00
R4830:Vps13b UTSW 15 35,452,370 (GRCm39) missense possibly damaging 0.94
R4835:Vps13b UTSW 15 35,869,518 (GRCm39) missense probably damaging 1.00
R4835:Vps13b UTSW 15 35,910,439 (GRCm39) missense probably benign
R4857:Vps13b UTSW 15 35,456,800 (GRCm39) missense probably benign 0.01
R4891:Vps13b UTSW 15 35,640,661 (GRCm39) splice site probably null
R5095:Vps13b UTSW 15 35,923,348 (GRCm39) missense probably damaging 1.00
R5110:Vps13b UTSW 15 35,770,955 (GRCm39) missense probably damaging 0.99
R5147:Vps13b UTSW 15 35,456,824 (GRCm39) missense probably benign 0.32
R5153:Vps13b UTSW 15 35,422,599 (GRCm39) missense probably damaging 0.99
R5257:Vps13b UTSW 15 35,794,567 (GRCm39) missense possibly damaging 0.75
R5258:Vps13b UTSW 15 35,794,567 (GRCm39) missense possibly damaging 0.75
R5296:Vps13b UTSW 15 35,876,559 (GRCm39) missense probably damaging 1.00
R5386:Vps13b UTSW 15 35,640,674 (GRCm39) critical splice acceptor site probably null
R5396:Vps13b UTSW 15 35,887,094 (GRCm39) missense probably damaging 0.99
R5412:Vps13b UTSW 15 35,533,531 (GRCm39) missense probably damaging 1.00
R5488:Vps13b UTSW 15 35,770,688 (GRCm39) missense probably benign
R5489:Vps13b UTSW 15 35,770,688 (GRCm39) missense probably benign
R5503:Vps13b UTSW 15 35,452,312 (GRCm39) missense probably damaging 0.97
R5575:Vps13b UTSW 15 35,930,065 (GRCm39) missense probably damaging 1.00
R5781:Vps13b UTSW 15 35,794,181 (GRCm39) missense probably damaging 0.97
R5872:Vps13b UTSW 15 35,869,497 (GRCm39) missense possibly damaging 0.56
R5876:Vps13b UTSW 15 35,917,207 (GRCm39) missense probably damaging 0.99
R5994:Vps13b UTSW 15 35,875,918 (GRCm39) missense probably damaging 1.00
R6031:Vps13b UTSW 15 35,472,114 (GRCm39) missense probably damaging 1.00
R6031:Vps13b UTSW 15 35,472,114 (GRCm39) missense probably damaging 1.00
R6045:Vps13b UTSW 15 35,671,462 (GRCm39) missense probably damaging 0.99
R6143:Vps13b UTSW 15 35,668,884 (GRCm39) missense probably damaging 0.99
R6147:Vps13b UTSW 15 35,930,177 (GRCm39) missense probably benign 0.16
R6218:Vps13b UTSW 15 35,770,610 (GRCm39) missense probably benign 0.00
R6447:Vps13b UTSW 15 35,572,272 (GRCm39) missense probably benign 0.02
R6555:Vps13b UTSW 15 35,846,993 (GRCm39) missense probably damaging 1.00
R6578:Vps13b UTSW 15 35,446,247 (GRCm39) missense probably damaging 0.99
R6640:Vps13b UTSW 15 35,617,842 (GRCm39) missense possibly damaging 0.93
R6645:Vps13b UTSW 15 35,910,451 (GRCm39) missense probably benign 0.25
R6711:Vps13b UTSW 15 35,887,395 (GRCm39) missense probably damaging 1.00
R6727:Vps13b UTSW 15 35,770,829 (GRCm39) missense probably benign 0.19
R6737:Vps13b UTSW 15 35,910,757 (GRCm39) missense probably damaging 1.00
R6844:Vps13b UTSW 15 35,877,736 (GRCm39) missense probably benign 0.06
R6849:Vps13b UTSW 15 35,905,455 (GRCm39) missense probably damaging 1.00
R6861:Vps13b UTSW 15 35,576,541 (GRCm39) missense probably damaging 0.99
R6938:Vps13b UTSW 15 35,423,344 (GRCm39) missense probably damaging 0.99
R6943:Vps13b UTSW 15 35,448,835 (GRCm39) missense possibly damaging 0.95
R6989:Vps13b UTSW 15 35,448,727 (GRCm39) missense probably benign 0.02
R7092:Vps13b UTSW 15 35,640,780 (GRCm39) missense probably damaging 1.00
R7232:Vps13b UTSW 15 35,877,703 (GRCm39) missense probably damaging 1.00
R7307:Vps13b UTSW 15 35,841,691 (GRCm39) missense probably benign
R7400:Vps13b UTSW 15 35,379,046 (GRCm39) missense probably damaging 1.00
R7414:Vps13b UTSW 15 35,910,973 (GRCm39) missense probably damaging 1.00
R7497:Vps13b UTSW 15 35,876,843 (GRCm39) missense probably benign 0.38
R7500:Vps13b UTSW 15 35,910,670 (GRCm39) missense possibly damaging 0.74
R7603:Vps13b UTSW 15 35,576,585 (GRCm39) missense probably damaging 0.98
R7605:Vps13b UTSW 15 35,770,792 (GRCm39) missense probably damaging 0.97
R7849:Vps13b UTSW 15 35,423,378 (GRCm39) missense probably damaging 0.99
R7984:Vps13b UTSW 15 35,880,059 (GRCm39) missense probably benign
R8094:Vps13b UTSW 15 35,669,052 (GRCm39) critical splice donor site probably null
R8097:Vps13b UTSW 15 35,709,492 (GRCm39) missense probably benign 0.38
R8131:Vps13b UTSW 15 35,372,255 (GRCm39) critical splice donor site probably null
R8139:Vps13b UTSW 15 35,607,418 (GRCm39) nonsense probably null
R8174:Vps13b UTSW 15 35,709,456 (GRCm39) nonsense probably null
R8225:Vps13b UTSW 15 35,794,528 (GRCm39) missense probably damaging 0.99
R8239:Vps13b UTSW 15 35,597,550 (GRCm39) missense probably damaging 1.00
R8244:Vps13b UTSW 15 35,917,349 (GRCm39) missense probably damaging 1.00
R8303:Vps13b UTSW 15 35,640,063 (GRCm39) missense probably damaging 1.00
R8311:Vps13b UTSW 15 35,887,100 (GRCm39) missense probably benign 0.37
R8443:Vps13b UTSW 15 35,455,246 (GRCm39) missense probably benign
R8494:Vps13b UTSW 15 35,422,594 (GRCm39) missense probably damaging 0.99
R8499:Vps13b UTSW 15 35,841,466 (GRCm39) missense probably damaging 1.00
R8506:Vps13b UTSW 15 35,446,891 (GRCm39) missense probably benign 0.31
R8559:Vps13b UTSW 15 35,876,788 (GRCm39) missense probably damaging 1.00
R8686:Vps13b UTSW 15 35,925,535 (GRCm39) missense probably damaging 0.99
R8782:Vps13b UTSW 15 35,422,483 (GRCm39) missense possibly damaging 0.93
R8806:Vps13b UTSW 15 35,472,212 (GRCm39) critical splice donor site probably benign
R8824:Vps13b UTSW 15 35,533,445 (GRCm39) missense probably damaging 0.99
R9024:Vps13b UTSW 15 35,923,470 (GRCm39) missense probably damaging 0.97
R9038:Vps13b UTSW 15 35,875,931 (GRCm39) missense possibly damaging 0.70
R9054:Vps13b UTSW 15 35,422,537 (GRCm39) missense probably damaging 1.00
R9091:Vps13b UTSW 15 35,770,919 (GRCm39) missense probably benign 0.13
R9129:Vps13b UTSW 15 35,448,793 (GRCm39) missense probably damaging 1.00
R9214:Vps13b UTSW 15 35,623,892 (GRCm39) missense probably damaging 0.99
R9237:Vps13b UTSW 15 35,841,479 (GRCm39) missense probably damaging 1.00
R9256:Vps13b UTSW 15 35,623,925 (GRCm39) missense possibly damaging 0.95
R9270:Vps13b UTSW 15 35,770,919 (GRCm39) missense probably benign 0.13
R9279:Vps13b UTSW 15 35,572,290 (GRCm39) missense probably damaging 0.97
R9291:Vps13b UTSW 15 35,847,059 (GRCm39) missense probably damaging 1.00
R9342:Vps13b UTSW 15 35,455,200 (GRCm39) missense possibly damaging 0.94
R9404:Vps13b UTSW 15 35,876,565 (GRCm39) missense probably damaging 1.00
R9488:Vps13b UTSW 15 35,447,880 (GRCm39) missense possibly damaging 0.77
R9509:Vps13b UTSW 15 35,841,457 (GRCm39) missense possibly damaging 0.79
R9610:Vps13b UTSW 15 35,642,555 (GRCm39) missense possibly damaging 0.85
R9611:Vps13b UTSW 15 35,642,555 (GRCm39) missense possibly damaging 0.85
R9658:Vps13b UTSW 15 35,623,774 (GRCm39) missense probably benign 0.00
R9674:Vps13b UTSW 15 35,607,380 (GRCm39) missense probably damaging 0.98
R9696:Vps13b UTSW 15 35,675,033 (GRCm39) missense possibly damaging 0.56
R9767:Vps13b UTSW 15 35,910,403 (GRCm39) missense probably damaging 1.00
R9797:Vps13b UTSW 15 35,675,022 (GRCm39) missense probably damaging 1.00
RF020:Vps13b UTSW 15 35,925,552 (GRCm39) missense probably null 1.00
X0026:Vps13b UTSW 15 35,910,792 (GRCm39) missense probably damaging 1.00
X0028:Vps13b UTSW 15 35,709,577 (GRCm39) missense probably benign 0.00
Z1177:Vps13b UTSW 15 35,669,031 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTCTCACCAGTCGTCAATTGTG -3'
(R):5'- GCTGGGACACAATCAAATGG -3'

Sequencing Primer
(F):5'- CACCAGTCGTCAATTGTGAAAAATC -3'
(R):5'- ACAGGTCTAGTTCTAAGTCACCGG -3'
Posted On 2014-07-14