Mutagenetix > Incidental Mutation

Incidental Mutation 'R1939:Itga8'

213777

Institutional Source

Beutler Lab

Gene Symbol

Itga8

Ensembl Gene

ENSMUSG00000026768

Gene Name

integrin alpha 8

Synonyms

MMRRC Submission

039957-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.898) question?

Stock #

R1939 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

12106632-12301922 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 12300846 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Alanine at position 111 (D111A)

Ref Sequence

ENSEMBL: ENSMUSP00000134154 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028106] [ENSMUST00000172791]

AlphaFold

A2ARA8

Predicted Effect

probably damaging
Transcript: ENSMUST00000028106
AA Change: D111A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000028106
Gene: ENSMUSG00000026768
AA Change: D111A

Domain	Start	End	E-Value	Type
signal peptide	1	37	N/A	INTRINSIC
Int_alpha	52	112	8.48e-8	SMART
Int_alpha	197	244	4.8e1	SMART
Int_alpha	262	312	5.91e-7	SMART
Int_alpha	316	377	6.94e-13	SMART
Int_alpha	381	437	1.92e-15	SMART
Int_alpha	445	494	8.23e-6	SMART
SCOP:d1m1xa2	643	780	2e-46	SMART
SCOP:d1m1xa3	784	1000	2e-80	SMART
transmembrane domain	1011	1033	N/A	INTRINSIC
Pfam:Integrin_alpha	1034	1048	2.5e-7	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130548

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141477

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148089

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150037

Predicted Effect

probably damaging
Transcript: ENSMUST00000172791
AA Change: D111A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000134154
Gene: ENSMUSG00000026768
AA Change: D111A

Domain	Start	End	E-Value	Type
signal peptide	1	37	N/A	INTRINSIC
Int_alpha	52	112	8.48e-8	SMART
Int_alpha	197	244	4.8e1	SMART
Int_alpha	262	312	5.91e-7	SMART
Int_alpha	316	377	6.94e-13	SMART
Int_alpha	381	437	1.92e-15	SMART
Int_alpha	445	494	8.23e-6	SMART

Coding Region Coverage

1x: 97.5%
3x: 97.0%
10x: 95.6%
20x: 93.2%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the integrin family of cell surface proteins that mediate cellular interactions with the extracellular matrix and other cells. The encoded protein undergoes proteolytic processing to generate the disulfide-linked heterodimeric alpha subunit which, in turn associates with a beta subunit to form the functional integrin receptor. Mice lacking the encoded protein mostly die after birth due to kidney defects, but some of animals that survive exhibit defects in the sensory hair cells of the inner ear. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for disruptions in this gene usually die by the end of the second day after birth. Those that do survive have reduced kidneys and abnormal steriocilia in the inner ear. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700020L24Rik	T	A	11: 83,440,304	W11R	probably damaging	Het
2700049A03Rik	A	G	12: 71,160,412		probably null	Het
3110002H16Rik	T	C	18: 12,180,505	L15P	probably damaging	Het
4933409G03Rik	T	C	2: 68,588,984	S26P	possibly damaging	Het
9930021J03Rik	A	G	19: 29,753,677	F712S	possibly damaging	Het
Ace2	A	T	X: 164,156,528	M123L	possibly damaging	Het
Acot3	A	G	12: 84,058,551	N264S	probably benign	Het
Acvr1c	A	T	2: 58,283,505	N248K	probably damaging	Het
Adam22	A	T	5: 8,330,015	F94L	probably damaging	Het
Adarb2	T	C	13: 8,203,322		probably null	Het
Aldh1b1	A	G	4: 45,802,755	M98V	possibly damaging	Het
Arfgef2	T	A	2: 166,873,628	V1331D	probably damaging	Het
Atf2	G	A	2: 73,846,219	P184S	probably damaging	Het
Atp8b3	A	T	10: 80,525,386	C785*	probably null	Het
Birc6	T	C	17: 74,670,337	S4362P	probably damaging	Het
Chn1	A	G	2: 73,624,901	C39R	probably damaging	Het
Cngb1	C	A	8: 95,299,692	G154W	probably damaging	Het
Cntnap5b	A	G	1: 99,967,348	H115R	probably benign	Het
Col23a1	A	G	11: 51,551,989	D159G	unknown	Het
Coro7	T	C	16: 4,628,732	E843G	probably benign	Het
Dnase2a	G	T	8: 84,910,895	A309S	possibly damaging	Het
Dync2h1	A	G	9: 7,139,159		probably null	Het
Engase	T	A	11: 118,479,186	N97K	probably damaging	Het
Fam83b	A	T	9: 76,493,080	M247K	probably damaging	Het
Fer	T	C	17: 63,973,128	S65P	probably damaging	Het
Fgf10	A	G	13: 118,789,152	R156G	probably damaging	Het
Gm10608	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	9: 119,160,716		probably null	Het
Gm5415	T	C	1: 32,545,546	I428V	probably damaging	Het
Gm904	T	C	13: 50,644,736		probably null	Het
Gpat2	T	A	2: 127,435,959	*802K	probably null	Het
Hcfc2	G	T	10: 82,702,450	R107L	probably damaging	Het
Jag1	C	G	2: 137,083,473	V1070L	possibly damaging	Het
Lama5	T	C	2: 180,190,921	N1646S	probably benign	Het
Lgals8	T	G	13: 12,459,188	I10L	probably benign	Het
Lrp1b	A	G	2: 40,697,589	S116P	unknown	Het
Mcpt1	A	T	14: 56,019,089	K94I	possibly damaging	Het
Mpnd	T	C	17: 56,015,920	F384S	probably damaging	Het
Mrgprb5	A	T	7: 48,168,938	N16K	probably benign	Het
Myo15b	A	G	11: 115,887,703	T1139A	probably benign	Het
Nat8f5	A	C	6: 85,817,819	I53R	possibly damaging	Het
Nav1	A	T	1: 135,465,898	L1034Q	probably damaging	Het
Nudt6	T	C	3: 37,405,230	Y54C	probably damaging	Het
Olfr1404	G	T	1: 173,215,932	A94S	probably benign	Het
Olfr482	A	G	7: 108,095,141	V143A	probably benign	Het
Olfr815	A	C	10: 129,902,101	M203R	probably damaging	Het
Olfr881	A	G	9: 37,993,089	N199S	probably benign	Het
Olfr893	T	A	9: 38,209,429	Y72*	probably null	Het
Osbpl8	A	T	10: 111,289,811	H784L	probably benign	Het
Osr1	T	G	12: 9,579,687	S187A	probably damaging	Het
Pcdhgc5	A	G	18: 37,821,950	Y759C	probably damaging	Het
Pkd1l2	G	T	8: 117,046,182	Y1035*	probably null	Het
Pla2g15	A	G	8: 106,163,295	T400A	probably damaging	Het
Pms1	A	C	1: 53,196,976	L715R	probably damaging	Het
Prkd1	T	C	12: 50,394,994	N254S	probably benign	Het
Prkdc	T	C	16: 15,835,913	V3868A	possibly damaging	Het
Ptprt	T	C	2: 161,927,640	N435S	probably benign	Het
Purb	T	C	11: 6,474,943	E315G	unknown	Het
Rap1b	A	T	10: 117,818,586	N116K	probably damaging	Het
Rp1l1	A	G	14: 64,029,593	N876S	probably benign	Het
Rps6ka4	T	A	19: 6,839,466	I114F	probably damaging	Het
Sh3bp2	A	G	5: 34,551,619	N19D	probably damaging	Het
Slc16a4	A	G	3: 107,301,001	M276V	probably benign	Het
Slc17a1	A	G	13: 23,875,881	T172A	probably benign	Het
Slc4a7	C	T	14: 14,748,581	A320V	probably damaging	Het
Slco1a6	T	A	6: 142,133,230	Y113F	probably damaging	Het
Srsf6	C	T	2: 162,934,483		probably benign	Het
St3gal6	A	T	16: 58,473,561		probably null	Het
Tdp2	A	G	13: 24,841,277	D343G	probably benign	Het
Tecpr2	T	A	12: 110,933,169	L657Q	probably damaging	Het
Tet2	T	C	3: 133,488,638	T12A	possibly damaging	Het
Trappc6a	T	A	7: 19,514,501	F28I	probably damaging	Het
Trim32	G	A	4: 65,614,066	V287I	probably benign	Het
Trpd52l3	T	C	19: 30,003,889	S15P	probably damaging	Het
Tsnaxip1	A	G	8: 105,840,038	I169V	probably benign	Het
Ttc34	G	A	4: 154,865,682	A1031T	possibly damaging	Het
Ttll11	T	A	2: 35,940,753	Q18L	probably null	Het
Ttll8	A	T	15: 88,915,486	I584N	probably damaging	Het
Ubiad1	A	G	4: 148,444,011	L147P	probably damaging	Het
Ucp3	T	C	7: 100,480,664	V171A	probably benign	Het
Vmn1r174	T	A	7: 23,754,107	I66N	probably damaging	Het
Vmn2r13	T	C	5: 109,191,986	D41G	possibly damaging	Het
Vmn2r4	T	C	3: 64,398,555	D393G	probably benign	Het
Wipf2	C	T	11: 98,892,410	R221*	probably null	Het
Zfp976	C	A	7: 42,613,681	C244F	unknown	Het
Zmym5	A	G	14: 56,799,120	V190A	probably damaging	Het

Other mutations in Itga8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00806:Itga8	APN	2	12255966	nonsense	probably null
IGL00820:Itga8	APN	2	12232892	missense	possibly damaging	0.85
IGL01409:Itga8	APN	2	12191714	missense	probably benign
IGL01508:Itga8	APN	2	12232802	missense	possibly damaging	0.67
IGL01585:Itga8	APN	2	12160312	splice site	probably benign
IGL01590:Itga8	APN	2	12160333	missense	probably damaging	1.00
IGL01743:Itga8	APN	2	12265333	missense	probably benign	0.04
IGL02634:Itga8	APN	2	12140478	missense	possibly damaging	0.55
IGL02805:Itga8	APN	2	12189480	missense	possibly damaging	0.83
IGL03200:Itga8	APN	2	12191199	missense	probably benign	0.00
IGL03218:Itga8	APN	2	12111025	missense	possibly damaging	0.77
IGL03248:Itga8	APN	2	12132516	missense	probably benign	0.20
PIT4576001:Itga8	UTSW	2	12230092	missense	probably benign	0.19
R0196:Itga8	UTSW	2	12204729	critical splice donor site	probably null
R0356:Itga8	UTSW	2	12182721	missense	possibly damaging	0.73
R0466:Itga8	UTSW	2	12232886	missense	probably damaging	1.00
R0530:Itga8	UTSW	2	12191816	missense	probably damaging	0.99
R0715:Itga8	UTSW	2	12191242	splice site	probably benign
R0800:Itga8	UTSW	2	12193551	missense	possibly damaging	0.95
R0881:Itga8	UTSW	2	12262192	splice site	probably null
R1675:Itga8	UTSW	2	12200163	missense	probably damaging	0.99
R1758:Itga8	UTSW	2	12265333	missense	possibly damaging	0.83
R2187:Itga8	UTSW	2	12194420	missense	possibly damaging	0.60
R2295:Itga8	UTSW	2	12182709	missense	probably benign	0.38
R2356:Itga8	UTSW	2	12200141	missense	probably benign
R2371:Itga8	UTSW	2	12253466	missense	probably damaging	1.00
R2412:Itga8	UTSW	2	12301715	missense	probably benign
R2440:Itga8	UTSW	2	12178680	missense	possibly damaging	0.70
R2848:Itga8	UTSW	2	12160404	missense	probably damaging	0.98
R3730:Itga8	UTSW	2	12193510	missense	possibly damaging	0.92
R3933:Itga8	UTSW	2	12189519	missense	probably benign
R3982:Itga8	UTSW	2	12300963	missense	possibly damaging	0.92
R4513:Itga8	UTSW	2	12182736	missense	probably benign	0.01
R4514:Itga8	UTSW	2	12182736	missense	probably benign	0.01
R4660:Itga8	UTSW	2	12265258	missense	probably damaging	1.00
R4890:Itga8	UTSW	2	12193291	splice site	probably benign
R5533:Itga8	UTSW	2	12160350	missense	possibly damaging	0.90
R5619:Itga8	UTSW	2	12265328	missense	probably damaging	1.00
R5720:Itga8	UTSW	2	12111087	missense	probably damaging	0.99
R5749:Itga8	UTSW	2	12262078	missense	probably damaging	1.00
R5930:Itga8	UTSW	2	12230208	missense	possibly damaging	0.84
R5954:Itga8	UTSW	2	12132486	missense	probably damaging	0.99
R6035:Itga8	UTSW	2	12191714	missense	probably benign
R6035:Itga8	UTSW	2	12191714	missense	probably benign
R6211:Itga8	UTSW	2	12193509	missense	probably damaging	1.00
R6337:Itga8	UTSW	2	12253469	nonsense	probably null
R6442:Itga8	UTSW	2	12230143	missense	probably benign	0.00
R6491:Itga8	UTSW	2	12204776	missense	probably damaging	1.00
R6543:Itga8	UTSW	2	12301644	missense	probably damaging	0.99
R6574:Itga8	UTSW	2	12230161	missense	probably benign	0.17
R6760:Itga8	UTSW	2	12301640	missense	probably damaging	1.00
R6858:Itga8	UTSW	2	12200081	missense	probably benign	0.00
R6943:Itga8	UTSW	2	12155371	critical splice donor site	probably null
R7048:Itga8	UTSW	2	12111084	missense	probably damaging	0.99
R7203:Itga8	UTSW	2	12230095	missense	possibly damaging	0.77
R7266:Itga8	UTSW	2	12232901	missense	probably damaging	1.00
R7323:Itga8	UTSW	2	12262129	missense	probably damaging	1.00
R7540:Itga8	UTSW	2	12111037	missense	possibly damaging	0.82
R7637:Itga8	UTSW	2	12109187	missense	probably damaging	1.00
R7748:Itga8	UTSW	2	12230239	missense	possibly damaging	0.80
R7848:Itga8	UTSW	2	12191737	missense	probably damaging	0.99
R8031:Itga8	UTSW	2	12155486	missense	probably benign
R8077:Itga8	UTSW	2	12242433	missense	probably benign	0.09
R8757:Itga8	UTSW	2	12262129	missense	probably damaging	1.00
R8759:Itga8	UTSW	2	12262129	missense	probably damaging	1.00
R8772:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8773:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8774:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8774-TAIL:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8775:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8775-TAIL:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8808:Itga8	UTSW	2	12132517	nonsense	probably null
R8898:Itga8	UTSW	2	12140395	missense	probably benign	0.05
R8962:Itga8	UTSW	2	12191234	missense	possibly damaging	0.94
R9056:Itga8	UTSW	2	12230208	missense	possibly damaging	0.84
R9155:Itga8	UTSW	2	12189519	missense	probably benign
R9354:Itga8	UTSW	2	12232857	missense	possibly damaging	0.94
R9563:Itga8	UTSW	2	12160408	missense	possibly damaging	0.83
R9589:Itga8	UTSW	2	12232890	missense	probably damaging	1.00
R9663:Itga8	UTSW	2	12191769	missense	probably benign	0.00
Z1176:Itga8	UTSW	2	12247518	missense	probably damaging	1.00
Z1176:Itga8	UTSW	2	12262136	missense	probably benign	0.01
Z1176:Itga8	UTSW	2	12301832	start gained	probably benign
Z1177:Itga8	UTSW	2	12300933	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- TCACAGCTGTGGGTTTCTAC -3'
(R):5'- TGCTTCTACAGACTGGGCAC -3'

Sequencing Primer
(F):5'- GGGTTTCTACTGGTCCCAAGC -3'
(R):5'- CTGGGCACACGGGTAAATGTTC -3'

Posted On

2014-07-14