Incidental Mutation 'R1939:Itga8'
ID 213777
Institutional Source Beutler Lab
Gene Symbol Itga8
Ensembl Gene ENSMUSG00000026768
Gene Name integrin alpha 8
Synonyms
MMRRC Submission 039957-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.870) question?
Stock # R1939 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 12111443-12306733 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 12305657 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Alanine at position 111 (D111A)
Ref Sequence ENSEMBL: ENSMUSP00000134154 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028106] [ENSMUST00000172791]
AlphaFold A2ARA8
Predicted Effect probably damaging
Transcript: ENSMUST00000028106
AA Change: D111A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028106
Gene: ENSMUSG00000026768
AA Change: D111A

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
Int_alpha 52 112 8.48e-8 SMART
Int_alpha 197 244 4.8e1 SMART
Int_alpha 262 312 5.91e-7 SMART
Int_alpha 316 377 6.94e-13 SMART
Int_alpha 381 437 1.92e-15 SMART
Int_alpha 445 494 8.23e-6 SMART
SCOP:d1m1xa2 643 780 2e-46 SMART
SCOP:d1m1xa3 784 1000 2e-80 SMART
transmembrane domain 1011 1033 N/A INTRINSIC
Pfam:Integrin_alpha 1034 1048 2.5e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130548
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141477
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148089
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150037
Predicted Effect probably damaging
Transcript: ENSMUST00000172791
AA Change: D111A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134154
Gene: ENSMUSG00000026768
AA Change: D111A

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
Int_alpha 52 112 8.48e-8 SMART
Int_alpha 197 244 4.8e1 SMART
Int_alpha 262 312 5.91e-7 SMART
Int_alpha 316 377 6.94e-13 SMART
Int_alpha 381 437 1.92e-15 SMART
Int_alpha 445 494 8.23e-6 SMART
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the integrin family of cell surface proteins that mediate cellular interactions with the extracellular matrix and other cells. The encoded protein undergoes proteolytic processing to generate the disulfide-linked heterodimeric alpha subunit which, in turn associates with a beta subunit to form the functional integrin receptor. Mice lacking the encoded protein mostly die after birth due to kidney defects, but some of animals that survive exhibit defects in the sensory hair cells of the inner ear. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for disruptions in this gene usually die by the end of the second day after birth. Those that do survive have reduced kidneys and abnormal steriocilia in the inner ear. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020L24Rik T A 11: 83,331,130 (GRCm39) W11R probably damaging Het
2700049A03Rik A G 12: 71,207,186 (GRCm39) probably null Het
4933409G03Rik T C 2: 68,419,328 (GRCm39) S26P possibly damaging Het
Ace2 A T X: 162,939,524 (GRCm39) M123L possibly damaging Het
Acot3 A G 12: 84,105,325 (GRCm39) N264S probably benign Het
Acvr1c A T 2: 58,173,517 (GRCm39) N248K probably damaging Het
Adam22 A T 5: 8,380,015 (GRCm39) F94L probably damaging Het
Adarb2 T C 13: 8,253,358 (GRCm39) probably null Het
Aldh1b1 A G 4: 45,802,755 (GRCm39) M98V possibly damaging Het
Arfgef2 T A 2: 166,715,548 (GRCm39) V1331D probably damaging Het
Atf2 G A 2: 73,676,563 (GRCm39) P184S probably damaging Het
Atp8b3 A T 10: 80,361,220 (GRCm39) C785* probably null Het
Birc6 T C 17: 74,977,332 (GRCm39) S4362P probably damaging Het
Brd10 A G 19: 29,731,077 (GRCm39) F712S possibly damaging Het
Chn1 A G 2: 73,455,245 (GRCm39) C39R probably damaging Het
Cngb1 C A 8: 96,026,320 (GRCm39) G154W probably damaging Het
Cntnap5b A G 1: 99,895,073 (GRCm39) H115R probably benign Het
Col23a1 A G 11: 51,442,816 (GRCm39) D159G unknown Het
Coro7 T C 16: 4,446,596 (GRCm39) E843G probably benign Het
Dnase2a G T 8: 85,637,524 (GRCm39) A309S possibly damaging Het
Dync2h1 A G 9: 7,139,159 (GRCm39) probably null Het
Engase T A 11: 118,370,012 (GRCm39) N97K probably damaging Het
Fam83b A T 9: 76,400,362 (GRCm39) M247K probably damaging Het
Fer T C 17: 64,280,123 (GRCm39) S65P probably damaging Het
Fgf10 A G 13: 118,925,688 (GRCm39) R156G probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 118,989,784 (GRCm39) probably null Het
Gm904 T C 13: 50,798,772 (GRCm39) probably null Het
Gpat2 T A 2: 127,277,879 (GRCm39) *802K probably null Het
Hcfc2 G T 10: 82,538,284 (GRCm39) R107L probably damaging Het
Jag1 C G 2: 136,925,393 (GRCm39) V1070L possibly damaging Het
Lama5 T C 2: 179,832,714 (GRCm39) N1646S probably benign Het
Lgals8 T G 13: 12,474,069 (GRCm39) I10L probably benign Het
Lrp1b A G 2: 40,587,601 (GRCm39) S116P unknown Het
Mcpt1 A T 14: 56,256,546 (GRCm39) K94I possibly damaging Het
Mpnd T C 17: 56,322,920 (GRCm39) F384S probably damaging Het
Mrgprb5 A T 7: 47,818,686 (GRCm39) N16K probably benign Het
Myo15b A G 11: 115,778,529 (GRCm39) T1139A probably benign Het
Nat8f5 A C 6: 85,794,801 (GRCm39) I53R possibly damaging Het
Nav1 A T 1: 135,393,636 (GRCm39) L1034Q probably damaging Het
Nudt6 T C 3: 37,459,379 (GRCm39) Y54C probably damaging Het
Or10j3b G T 1: 173,043,499 (GRCm39) A94S probably benign Het
Or5p58 A G 7: 107,694,348 (GRCm39) V143A probably benign Het
Or6c217 A C 10: 129,737,970 (GRCm39) M203R probably damaging Het
Or8b35 A G 9: 37,904,385 (GRCm39) N199S probably benign Het
Or8c15 T A 9: 38,120,725 (GRCm39) Y72* probably null Het
Osbpl8 A T 10: 111,125,672 (GRCm39) H784L probably benign Het
Osr1 T G 12: 9,629,687 (GRCm39) S187A probably damaging Het
Pcdhgc5 A G 18: 37,955,003 (GRCm39) Y759C probably damaging Het
Pkd1l2 G T 8: 117,772,921 (GRCm39) Y1035* probably null Het
Pla2g15 A G 8: 106,889,927 (GRCm39) T400A probably damaging Het
Pms1 A C 1: 53,236,135 (GRCm39) L715R probably damaging Het
Prkd1 T C 12: 50,441,777 (GRCm39) N254S probably benign Het
Prkdc T C 16: 15,653,777 (GRCm39) V3868A possibly damaging Het
Ptprt T C 2: 161,769,560 (GRCm39) N435S probably benign Het
Purb T C 11: 6,424,943 (GRCm39) E315G unknown Het
Rap1b A T 10: 117,654,491 (GRCm39) N116K probably damaging Het
Rmc1 T C 18: 12,313,562 (GRCm39) L15P probably damaging Het
Rp1l1 A G 14: 64,267,042 (GRCm39) N876S probably benign Het
Rps6ka4 T A 19: 6,816,834 (GRCm39) I114F probably damaging Het
Semp2l1 T C 1: 32,584,627 (GRCm39) I428V probably damaging Het
Sh3bp2 A G 5: 34,708,963 (GRCm39) N19D probably damaging Het
Slc16a4 A G 3: 107,208,317 (GRCm39) M276V probably benign Het
Slc17a1 A G 13: 24,059,864 (GRCm39) T172A probably benign Het
Slc4a7 C T 14: 14,748,581 (GRCm38) A320V probably damaging Het
Slco1a6 T A 6: 142,078,956 (GRCm39) Y113F probably damaging Het
Srsf6 C T 2: 162,776,403 (GRCm39) probably benign Het
St3gal6 A T 16: 58,293,924 (GRCm39) probably null Het
Tdp2 A G 13: 25,025,260 (GRCm39) D343G probably benign Het
Tecpr2 T A 12: 110,899,603 (GRCm39) L657Q probably damaging Het
Tet2 T C 3: 133,194,399 (GRCm39) T12A possibly damaging Het
Trappc6a T A 7: 19,248,426 (GRCm39) F28I probably damaging Het
Trim32 G A 4: 65,532,303 (GRCm39) V287I probably benign Het
Trpd52l3 T C 19: 29,981,289 (GRCm39) S15P probably damaging Het
Tsnaxip1 A G 8: 106,566,670 (GRCm39) I169V probably benign Het
Ttc34 G A 4: 154,950,139 (GRCm39) A1031T possibly damaging Het
Ttll11 T A 2: 35,830,765 (GRCm39) Q18L probably null Het
Ttll8 A T 15: 88,799,689 (GRCm39) I584N probably damaging Het
Ubiad1 A G 4: 148,528,468 (GRCm39) L147P probably damaging Het
Ucp3 T C 7: 100,129,871 (GRCm39) V171A probably benign Het
Vmn1r174 T A 7: 23,453,532 (GRCm39) I66N probably damaging Het
Vmn2r13 T C 5: 109,339,852 (GRCm39) D41G possibly damaging Het
Vmn2r4 T C 3: 64,305,976 (GRCm39) D393G probably benign Het
Wipf2 C T 11: 98,783,236 (GRCm39) R221* probably null Het
Zfp976 C A 7: 42,263,105 (GRCm39) C244F unknown Het
Zmym5 A G 14: 57,036,577 (GRCm39) V190A probably damaging Het
Other mutations in Itga8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00806:Itga8 APN 2 12,260,777 (GRCm39) nonsense probably null
IGL00820:Itga8 APN 2 12,237,703 (GRCm39) missense possibly damaging 0.85
IGL01409:Itga8 APN 2 12,196,525 (GRCm39) missense probably benign
IGL01508:Itga8 APN 2 12,237,613 (GRCm39) missense possibly damaging 0.67
IGL01585:Itga8 APN 2 12,165,123 (GRCm39) splice site probably benign
IGL01590:Itga8 APN 2 12,165,144 (GRCm39) missense probably damaging 1.00
IGL01743:Itga8 APN 2 12,270,144 (GRCm39) missense probably benign 0.04
IGL02634:Itga8 APN 2 12,145,289 (GRCm39) missense possibly damaging 0.55
IGL02805:Itga8 APN 2 12,194,291 (GRCm39) missense possibly damaging 0.83
IGL03200:Itga8 APN 2 12,196,010 (GRCm39) missense probably benign 0.00
IGL03218:Itga8 APN 2 12,115,836 (GRCm39) missense possibly damaging 0.77
IGL03248:Itga8 APN 2 12,137,327 (GRCm39) missense probably benign 0.20
PIT4576001:Itga8 UTSW 2 12,234,903 (GRCm39) missense probably benign 0.19
R0196:Itga8 UTSW 2 12,209,540 (GRCm39) critical splice donor site probably null
R0356:Itga8 UTSW 2 12,187,532 (GRCm39) missense possibly damaging 0.73
R0466:Itga8 UTSW 2 12,237,697 (GRCm39) missense probably damaging 1.00
R0530:Itga8 UTSW 2 12,196,627 (GRCm39) missense probably damaging 0.99
R0715:Itga8 UTSW 2 12,196,053 (GRCm39) splice site probably benign
R0800:Itga8 UTSW 2 12,198,362 (GRCm39) missense possibly damaging 0.95
R0881:Itga8 UTSW 2 12,267,003 (GRCm39) splice site probably null
R1675:Itga8 UTSW 2 12,204,974 (GRCm39) missense probably damaging 0.99
R1758:Itga8 UTSW 2 12,270,144 (GRCm39) missense possibly damaging 0.83
R2187:Itga8 UTSW 2 12,199,231 (GRCm39) missense possibly damaging 0.60
R2295:Itga8 UTSW 2 12,187,520 (GRCm39) missense probably benign 0.38
R2356:Itga8 UTSW 2 12,204,952 (GRCm39) missense probably benign
R2371:Itga8 UTSW 2 12,258,277 (GRCm39) missense probably damaging 1.00
R2412:Itga8 UTSW 2 12,306,526 (GRCm39) missense probably benign
R2440:Itga8 UTSW 2 12,183,491 (GRCm39) missense possibly damaging 0.70
R2848:Itga8 UTSW 2 12,165,215 (GRCm39) missense probably damaging 0.98
R3730:Itga8 UTSW 2 12,198,321 (GRCm39) missense possibly damaging 0.92
R3933:Itga8 UTSW 2 12,194,330 (GRCm39) missense probably benign
R3982:Itga8 UTSW 2 12,305,774 (GRCm39) missense possibly damaging 0.92
R4513:Itga8 UTSW 2 12,187,547 (GRCm39) missense probably benign 0.01
R4514:Itga8 UTSW 2 12,187,547 (GRCm39) missense probably benign 0.01
R4660:Itga8 UTSW 2 12,270,069 (GRCm39) missense probably damaging 1.00
R4890:Itga8 UTSW 2 12,198,102 (GRCm39) splice site probably benign
R5533:Itga8 UTSW 2 12,165,161 (GRCm39) missense possibly damaging 0.90
R5619:Itga8 UTSW 2 12,270,139 (GRCm39) missense probably damaging 1.00
R5720:Itga8 UTSW 2 12,115,898 (GRCm39) missense probably damaging 0.99
R5749:Itga8 UTSW 2 12,266,889 (GRCm39) missense probably damaging 1.00
R5930:Itga8 UTSW 2 12,235,019 (GRCm39) missense possibly damaging 0.84
R5954:Itga8 UTSW 2 12,137,297 (GRCm39) missense probably damaging 0.99
R6035:Itga8 UTSW 2 12,196,525 (GRCm39) missense probably benign
R6035:Itga8 UTSW 2 12,196,525 (GRCm39) missense probably benign
R6211:Itga8 UTSW 2 12,198,320 (GRCm39) missense probably damaging 1.00
R6337:Itga8 UTSW 2 12,258,280 (GRCm39) nonsense probably null
R6442:Itga8 UTSW 2 12,234,954 (GRCm39) missense probably benign 0.00
R6491:Itga8 UTSW 2 12,209,587 (GRCm39) missense probably damaging 1.00
R6543:Itga8 UTSW 2 12,306,455 (GRCm39) missense probably damaging 0.99
R6574:Itga8 UTSW 2 12,234,972 (GRCm39) missense probably benign 0.17
R6760:Itga8 UTSW 2 12,306,451 (GRCm39) missense probably damaging 1.00
R6858:Itga8 UTSW 2 12,204,892 (GRCm39) missense probably benign 0.00
R6943:Itga8 UTSW 2 12,160,182 (GRCm39) critical splice donor site probably null
R7048:Itga8 UTSW 2 12,115,895 (GRCm39) missense probably damaging 0.99
R7203:Itga8 UTSW 2 12,234,906 (GRCm39) missense possibly damaging 0.77
R7266:Itga8 UTSW 2 12,237,712 (GRCm39) missense probably damaging 1.00
R7323:Itga8 UTSW 2 12,266,940 (GRCm39) missense probably damaging 1.00
R7540:Itga8 UTSW 2 12,115,848 (GRCm39) missense possibly damaging 0.82
R7637:Itga8 UTSW 2 12,113,998 (GRCm39) missense probably damaging 1.00
R7748:Itga8 UTSW 2 12,235,050 (GRCm39) missense possibly damaging 0.80
R7848:Itga8 UTSW 2 12,196,548 (GRCm39) missense probably damaging 0.99
R8031:Itga8 UTSW 2 12,160,297 (GRCm39) missense probably benign
R8077:Itga8 UTSW 2 12,247,244 (GRCm39) missense probably benign 0.09
R8757:Itga8 UTSW 2 12,266,940 (GRCm39) missense probably damaging 1.00
R8759:Itga8 UTSW 2 12,266,940 (GRCm39) missense probably damaging 1.00
R8772:Itga8 UTSW 2 12,187,495 (GRCm39) missense probably damaging 1.00
R8773:Itga8 UTSW 2 12,187,495 (GRCm39) missense probably damaging 1.00
R8774:Itga8 UTSW 2 12,187,495 (GRCm39) missense probably damaging 1.00
R8774-TAIL:Itga8 UTSW 2 12,187,495 (GRCm39) missense probably damaging 1.00
R8775:Itga8 UTSW 2 12,187,495 (GRCm39) missense probably damaging 1.00
R8775-TAIL:Itga8 UTSW 2 12,187,495 (GRCm39) missense probably damaging 1.00
R8808:Itga8 UTSW 2 12,137,328 (GRCm39) nonsense probably null
R8898:Itga8 UTSW 2 12,145,206 (GRCm39) missense probably benign 0.05
R8962:Itga8 UTSW 2 12,196,045 (GRCm39) missense possibly damaging 0.94
R9056:Itga8 UTSW 2 12,235,019 (GRCm39) missense possibly damaging 0.84
R9155:Itga8 UTSW 2 12,194,330 (GRCm39) missense probably benign
R9354:Itga8 UTSW 2 12,237,668 (GRCm39) missense possibly damaging 0.94
R9563:Itga8 UTSW 2 12,165,219 (GRCm39) missense possibly damaging 0.83
R9589:Itga8 UTSW 2 12,237,701 (GRCm39) missense probably damaging 1.00
R9663:Itga8 UTSW 2 12,196,580 (GRCm39) missense probably benign 0.00
Z1176:Itga8 UTSW 2 12,306,643 (GRCm39) start gained probably benign
Z1176:Itga8 UTSW 2 12,266,947 (GRCm39) missense probably benign 0.01
Z1176:Itga8 UTSW 2 12,252,329 (GRCm39) missense probably damaging 1.00
Z1177:Itga8 UTSW 2 12,305,744 (GRCm39) missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TCACAGCTGTGGGTTTCTAC -3'
(R):5'- TGCTTCTACAGACTGGGCAC -3'

Sequencing Primer
(F):5'- GGGTTTCTACTGGTCCCAAGC -3'
(R):5'- CTGGGCACACGGGTAAATGTTC -3'
Posted On 2014-07-14